Fortune Journals

Journal of Womens Health and Development

ISSN: 2644-2884 Peer Reviewed Open Access
Submit Manuscript →

Identification of PRMT5 as a Diagnosis Biomarker for Cervical Cancer by Bioinformatics Analysis

Vol 5, Issue 4 Pages 240–246 Published: 03 Nov 2022

Xiaofeng Ma1, Lei Zhan1, Shiying Sun1, Yurong Song1, Qingyuan Wang1, Bing Wei1, Enlin Wang2*

1Department of Gynecology and Obstetrics, The Second Hospital of Anhui Medical University, Hefei, Anhui, 230601, China

2The Shool of life science, Anhui Medical University, Hefei, Anhui, 230032, China

*Corresponding author: Enlin Wang, The Shool of life science, Anhui Medical University, Hefei, Anhui, 230032, China.

Received: 24 October 2022; Accepted: 27 October 2022; Published: 03 November 2022

Article Information
Citation: Xiaofeng Ma, Lei Zhan, Shiying Sun, Yurong Song, Qingyuan Wang, Bing Wei, Enlin Wang. Identification of PRMT5 as a Diagnosis Biomarker for Cervical Cancer by Bioinformatics Analysis. Journal of Women’s Health and Development 5 (2022): 240-246.

DOI: 10.26502/fjwhd.2644-28840095

Share
Abstract

Cervical cancer (CC) is the fourth most common cancer among women worldwide. Early screening is helpful for the diagnosis and precision treatment of cervical cancer. Therefore, identification of CC related protein markers is required for cervical cancer diagnosis. In this study, we found the protein arginine N-methyltransferase 5 (PRMT5) was upregulated in CC patients compared with normal tissues through analysis of data from TCGA and GTEx datasets. Immunohistochemical staining and western blot confirmed that PRMT5 was indeed increased in the CC tissues. Furthermore, PRMT5 enhanced the ability of cell clone formation through activating AKT signaling pathway. Taken together, the higher expression of PRMT5 in the CC may be act as a prognostic biomarker, which involved in carcinogenesis by excessively activating AKT signaling pathway.

Keywords

AKT Pathway; Cervical Cancer; Diagnosis; PRMT5

Cervical cancer articles Cervical cancer Research articles Cervical cancer review articles Cervical cancer PubMed articles Cervical cancer PubMed Central articles Cervical cancer 2023 articles Cervical cancer 2024 articles Cervical cancer Scopus articles Cervical cancer impact factor journals Cervical cancer Scopus journals Cervical cancer PubMed journals Cervical cancer medical journals Cervical cancer free journals Cervical cancer best journals Cervical cancer top journals Cervical cancer free medical journals Cervical cancer famous journals Cervical cancer Google Scholar indexed journals PRMT5 articles PRMT5 Research articles PRMT5 review articles PRMT5 PubMed articles PRMT5 PubMed Central articles PRMT5 2023 articles PRMT5 2024 articles PRMT5 Scopus articles PRMT5 impact factor journals PRMT5 Scopus journals PRMT5 PubMed journals PRMT5 medical journals PRMT5 free journals PRMT5 best journals PRMT5 top journals PRMT5 free medical journals PRMT5 famous journals PRMT5 Google Scholar indexed journals prognostic biomarker articles prognostic biomarker Research articles prognostic biomarker review articles prognostic biomarker PubMed articles prognostic biomarker PubMed Central articles prognostic biomarker 2023 articles prognostic biomarker 2024 articles prognostic biomarker Scopus articles prognostic biomarker impact factor journals prognostic biomarker Scopus journals prognostic biomarker PubMed journals prognostic biomarker medical journals prognostic biomarker free journals prognostic biomarker best journals prognostic biomarker top journals prognostic biomarker free medical journals prognostic biomarker famous journals prognostic biomarker Google Scholar indexed journals AKT Pathway articles AKT Pathway Research articles AKT Pathway review articles AKT Pathway PubMed articles AKT Pathway PubMed Central articles AKT Pathway 2023 articles AKT Pathway 2024 articles AKT Pathway Scopus articles AKT Pathway impact factor journals AKT Pathway Scopus journals AKT Pathway PubMed journals AKT Pathway medical journals AKT Pathway free journals AKT Pathway best journals AKT Pathway top journals AKT Pathway free medical journals AKT Pathway famous journals AKT Pathway Google Scholar indexed journals Diagnosis articles Diagnosis Research articles Diagnosis review articles Diagnosis PubMed articles Diagnosis PubMed Central articles Diagnosis 2023 articles Diagnosis 2024 articles Diagnosis Scopus articles Diagnosis impact factor journals Diagnosis Scopus journals Diagnosis PubMed journals Diagnosis medical journals Diagnosis free journals Diagnosis best journals Diagnosis top journals Diagnosis free medical journals Diagnosis famous journals Diagnosis Google Scholar indexed journals symmetric dimethylarginines articles symmetric dimethylarginines Research articles symmetric dimethylarginines review articles symmetric dimethylarginines PubMed articles symmetric dimethylarginines PubMed Central articles symmetric dimethylarginines 2023 articles symmetric dimethylarginines 2024 articles symmetric dimethylarginines Scopus articles symmetric dimethylarginines impact factor journals symmetric dimethylarginines Scopus journals symmetric dimethylarginines PubMed journals symmetric dimethylarginines medical journals symmetric dimethylarginines free journals symmetric dimethylarginines best journals symmetric dimethylarginines top journals symmetric dimethylarginines free medical journals symmetric dimethylarginines famous journals symmetric dimethylarginines Google Scholar indexed journals asymmetric articles asymmetric Research articles asymmetric review articles asymmetric PubMed articles asymmetric PubMed Central articles asymmetric 2023 articles asymmetric 2024 articles asymmetric Scopus articles asymmetric impact factor journals asymmetric Scopus journals asymmetric PubMed journals asymmetric medical journals asymmetric free journals asymmetric best journals asymmetric top journals asymmetric free medical journals asymmetric famous journals asymmetric Google Scholar indexed journals Mono-Methylarginine articles Mono-Methylarginine Research articles Mono-Methylarginine review articles Mono-Methylarginine PubMed articles Mono-Methylarginine PubMed Central articles Mono-Methylarginine 2023 articles Mono-Methylarginine 2024 articles Mono-Methylarginine Scopus articles Mono-Methylarginine impact factor journals Mono-Methylarginine Scopus journals Mono-Methylarginine PubMed journals Mono-Methylarginine medical journals Mono-Methylarginine free journals Mono-Methylarginine best journals Mono-Methylarginine top journals Mono-Methylarginine free medical journals Mono-Methylarginine famous journals Mono-Methylarginine Google Scholar indexed journals epigenetic articles epigenetic Research articles epigenetic review articles epigenetic PubMed articles epigenetic PubMed Central articles epigenetic 2023 articles epigenetic 2024 articles epigenetic Scopus articles epigenetic impact factor journals epigenetic Scopus journals epigenetic PubMed journals epigenetic medical journals epigenetic free journals epigenetic best journals epigenetic top journals epigenetic free medical journals epigenetic famous journals epigenetic Google Scholar indexed journals non-epigenetic articles non-epigenetic Research articles non-epigenetic review articles non-epigenetic PubMed articles non-epigenetic PubMed Central articles non-epigenetic 2023 articles non-epigenetic 2024 articles non-epigenetic Scopus articles non-epigenetic impact factor journals non-epigenetic Scopus journals non-epigenetic PubMed journals non-epigenetic medical journals non-epigenetic free journals non-epigenetic best journals non-epigenetic top journals non-epigenetic free medical journals non-epigenetic famous journals non-epigenetic Google Scholar indexed journals

Article Details

1. Introduction

Cervical cancer is the fourth most common cancer among women worldwide. There are about 57,000 new cases and 311,000 deaths in 2018 [1]. The incidence and death rate has declined gradually in developed countries, due to cancer screening and HPV vaccination. However, in low-income and developing countries especially, cervical cancer remains the leading cause of death from cancer in women [2]. For example, in China, a significantly increasing incidence and mortality are observed which contribute 106,000 cases and 48,000 deaths to the global cervical cancer burden, especially many of whom are young women aged 15 to 44 years [3, 4]. It is worth noting that the incidence and death rate of cervical cancer is still increasing in developing countries in recent years due to the lack of effective prevention/screening methods [4]. Therefore, it is of great work to explore and develop more specific methods for early detection and prevention of cervical cancer. PRMT5 also named as Hsl7, Jbp1, Skb1, or Dart5 [5], serves as a protein methyl transferase that catalyzes methyl group on arginine residues in many proteins, which formed a Mono-Methylarginine (MMA), asymmetric (ADMA) and symmetric dimethylarginines (SDMA) [6]. PRMT5 controls gene expression by methylating histone/non-histone, which is implicated in a variety of cellular processes, such as cell proliferation and apoptosis [7], cancer metastasis [8], genes expression [9] and cell stemness [10]. Accumulating evidences indicated that dysregulation of PRMT5 was observed in multiple cancers via both epigenetic and non-epigenetic mechanisms. For instance, PRMT5 inhibits several miRNAs expression with its methylation modifications activity, which involved in tumor progression [11,12]. PRMT5 promoted the proliferation and metastasis of esophageal squamous cell carcinoma cells through LKB1/AMPK/mTOR signaling pathway [13]. In melanoma PRMT5 expression suppresses inflammation and antigen presentation cGAS/STING and NLRC5 pathways, indicating its inhibition could potentiate immunotherapy [14]. Although PRMT5 has been identified as a putative oncogene and its overexpression has been observed in several cancers [15,16]. However, the mechanism of PRMT5 in cervical cancer is still largely unexplored. In this study, bioinformatics analysis showed that PRMT5 was upregulated in CC tissues compared with the normal tissues. Moreover, immunohistochemical staining and western blot demonstrated that PRMT5 was indeed increased in the CC. Furthermore, we also found that PRMT5 promoted cell clone formation which involved in carcinogenesis by excessively activating AKT signaling pathway.

2. Materials and Methods

2.1 Materials

The antibodies were used as follows: anti-PRMT5 (ZEN BIO, 381019, 1:2000), anti-GAPDH (ZEN BIO, 200306-7E4, 1:10000), anti-HA (ZEN BIO, 301113 ,1:10000), anti-AKT (CST, #2920 ,1:2000), anti-p-AKT(Thr308) (CST, #13038,1:1000), anti-Rabbit IgG(H+L)-HRP secondary antibody (Abclonal, AS014, 1:10000), anti-Mouse IgG(H+L)-HRP secondary antibody (Abclonal, AS003, 1:10000). Immunohistochemical DAB staining kit (Solarbio life science, DA1010). Lipofectamine 2000 (Invitrogen, 11668-027).

2.2 Cell Culture and Transfection

Human cervical cancer cell lines Hela and SiHa were purchased from ATCC. Both cell lines were cultured in the DMEM medium supplemented with 10% fetal bovine serum (FBS, Gibco) under 37°C with 5% CO2. For the plasmid transfection, cells were transfected with indicated plasmids with Lipofectamine 2000 according to the manufacturer’s instruction.

2.3 Bioinformatics Collection and Analysis

RNA-seq data and clinical data of The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) were downloaded from the UCSC Xena database (https://xenabrowser.net/datapages/), including 33 common cancer types and paired normal tissues. R software v4.0.3 was performed for statistical analysis. If not otherwise stated, the p <0.05 is considered statistically significant.

2.4 Kaplan–Meier Plotter Database Analysis

The Overall Survival (OS), Relapse-Free survival (RFS) with PRMT5 gene expression were analyzed using the Kaplan–Meier Plotter database (http://kmplot.com/analysis/index). The screening conditions were set as: (1) start KM Plotter for cervical cancer (2) gene symbol: PRMT5 (3) survival: OS, RFS.

2.5 Immunoblotting

Cells were lysed with the RIPA lysis buffer plus PMSF for 30 min on ice. After centrifugation at 12,000 g for 15 min, the supernatants were boiled with loading buffer for 5 min. The equivalent protein samples were subjected into SDS-PAGE and then transferred to the PVDF membranes. The membranes were blocked with the slim milk for 1 h. After blocking, primary antibodies were added to incubated with membrane at 4? for overnight. Next, excess primary antibodies were washed by PBST and the signals were developed by the appropriate HRP-conjugated anti-mouse/rabbit secondary antibodies.

2.6 Patient Samples Collection and Immunohistochemistry

Cervical cancer tissues and normal cervical tissues were collected from Second Hospital, Anhui Medical University. All samples were verified by Institutional Ethics Committee. Tissue sections were deparaffinized and rehydrated with citrate buffer for antigen retrieval. Then all sections were blocked with 2.5% goat serum. Subsequently the sections were incubated with PRMT5 antibody at 4°C overnight and then immunoreaction with the biotinylated secondary antibody at room temperature for 1 h. Finally, signals were developed by DAB substrate kit and pictures were visualized under microscopy (Leica, LeicaDFC420C).

2.7 Cell Colony Formation Assay

The scramble, shPRMT5-1# and shPRMT5-2# Hela and SiHa cells (3 × 103) respectively were seeded in the 6-well plates and replaced with the fresh medium every 2 days until the clones were noted (about 2 weeks). After being washed with PBS, the clones were fixed with 4% paraformaldehyde (PFA) for 15 min and stained with 1% crystal violet for 2 h at room temperature. After the staining, the plates were rinsed with distilled water and dried. The images of the plates were collected and clones were counted directly. shPRMT5-1#: CCGGCTGGGCTCATTTGCTGACAATCTCGAGATTGTCAGCAAATGAGCCCAGTTTTTG. shPRMT5-2#: CCGGGCGTTTCAAGAGGGAGTTCATCTCGAGATGAAC TCCTCTTGAAACGCTTTTTG.

2.8 Statistical Analysis

To performed statistical analysis, GraphPad Prism 5.0 was used. Student t-test was applied to analysis the data. The data were presented as mean ± SD of two independently experiments in triplicate. The p<0.05 was set as the criterion for statistical significance.

3. Results

3.1 The Expression Analysis of PRMT5 in Pan-Cancer

To explore the correlation between PRMT5 expression profile and cancers, we first evaluated PRMT5 expression in pan-cancer from TCGA and GTEx datasets. As shown in Figure 1, high-expression of PRMT5 was observed in the majority of 33 cancers compared with normal groups. Except PCPG, the expressions of PRMT5 were significant enhanced in all 26 cancers (p<0.001) and were just slight enhanced in the THYM and UCEC (p<0.05) (Figure 1A, B). Briefly, there was a strong correlation between the expression of PRMT5 and cancers, which indicated PRMT5 may play a critical role in the tumorigenesis.

fortune-biomass-feedstock

Figure 1: The expression analysis of PRMT5 in Pan-Cancer. (A-B) The PRMT5 expression between 33 kinds of cancers and normal tissues according to the RNA-seq database from TCGA and GTEx. *p<0.05, **p<0.01, ***p<0.001.

3.2 Survival Analysis for the Relationship between PRMT5 Expression and Prognosis in Patients

306 cases of cervical cancer samples and 22 paired adjacent normal cases from TCGA and GTEx database were analyzed to validate the predictive results. Among all of cervical cancer, 253 cases were CSCC and 53 cases were CSAC. Cervical squamous cell carcinoma (CSCC) and cervical adenosquamous carcinoma (CASC) are two main pathological types in advanced cervical cancer patients [17]. We also found that the PRMT5 expression increased in both CSCC and CASC (Figure 2A). Furthermore, to evaluate the role of PRMT5 in the prognosis of cervical cancer patients, Kaplan–Meier plotter database was used to analyze the overall survival (OS) and relapse free survival (RFS) between high-PRMT5 group and low-PRMT5 group. As shown in Figure 2B, patients with high-expressed PRMT5 have the worse OS (OS HR=2.03, p<0.001) and RFS (RFS HR= 8.66, p<0.001) than the low-expressed patients, suggesting the PRMT5 is a negative prognosis molecular in the cervical cancer.

fortune-biomass-feedstock

Figure 2: The expression and survival rate analysis of PRMT5 in cervical cancer. A(a). The PRMT5 expression between 306 cervical cancer and 22 normal tissues. A(b-c). The PRMT5 expression in both CSCC and CASC subtypes compared with normal group. B(a). Influence of PRMT5 gene-expression levels on the overall survival (OS). B(b). Influence of PRMT5 gene-expression levels on the relapse-free survival (RFS).

3.3 Clinical Significance of PRMT5 in Human Cervical Cancer

To understand the clinical feature of PRMT5 in cervical cancer patients, who just received the surgery without any chemotherapy. IHC staining of PRMT5 in those patients revealed a stronger staining intensity than the normal tissues (Figure 3A). To further confirm this finding, we detected PRMT5 protein expression in a set of 10 cervical cancer patients using western blot assay. As shown in Figure 3B, PRMT5 protein expression was significantly increased in 7 of 10 patients. Collectively, these results suggest that the correlation of PRMT5 with cervical cancer generation and PRMT5 may be used for cervical cancer screening.

fortune-biomass-feedstock

Figure 3: Expression of PRMT5 in cervical cancer tissue. (A) The IHC staining of PRMT5 in cervical cancer patients and normal tissues. Strong PRMT5 expression in cervical cancer tissue. Weak PRMT5 expression in normal cervical tissues. (B) Expression of PRMT5 in cervical cancer and normal cervical tissues. N: normal. T: tumor.

3.4 PRMT5 Promotes Proliferation of Cervical Cancer Cells through Regulating AKT Pathway

To determine PRMT5 biological roles in cervical cancer cell lines, plasmid transfection and shRNA knockdown were performed in both Hela and SiHa cells. As presented in Figure 4, plasmid transfection increased protein levels of PRMT5 (Figure 4A(a)) and shRNA transfection reduced PRMT5 protein levels in cervical cancer cells (Figure 4A(b)). The colony formation assay demonstrated that PRMT5 upregulation significantly increased cell growth rate compared with cells treated with empty vector (Figure 4B, Hela: Figure 4C(a), SiHa: Figure 4C(b)), while knock-down of PRMT5 remarkably attenuated the colony formation ability in both Hela and SiHa cells compared with cells treated with mock shRNA (Figure 4B, Hela: Figure 4C(c), SiHa: Figure 4C(d)). In order to investigate the molecular mechanism underlying PRMT5-induced cell proliferation, we examined the AKT pathway in CC cells with PRMT5 overexpression or knock-down, because several previous studies indicated that AKT phosphorylation played a vital role in the generation and metastasis of CC [18]. The results demonstrated that knock-down of PRMT5 expression reduced the level of AKT phosphorylation (Hela: Figure 4D(a), SiHa: Figure 4D(c) ), while PRMT5 overexpression increased the level of AKT phosphorylation (Hela: Figure 4D(b), SiHa: Figure 4D(d)). These data confirmed that PRMT5 may promote the proliferation of CC cells through regulating AKT signaling pathway.

fortune-biomass-feedstock

Figure 4: PRMT5 promotes proliferation of cervical cancer cells through regulating AKT pathway A. Western blot analysis of PRMT5 protein level in cervical cancer cells transfected with PRMT5 over-expressed plasmid and siRNA knockdown. B-C. The colon formation in cervical cancer cells which knock down or over expressed PRMT5. D. The phosphorylation of AKT in the Hela (a-b) and SiHa cells (c-d) after knockdown or overexpression of PRMT5.

4. Discussion and Conclusions

Despite the incidence of cervical cancer has been dropped since mid-2000s, but the diversity of cervical cancer pathopoiesia remains less known. Cervical cancer is highly preventable and can be treated if detected at early stages [19]. Unfortunately, over 50% of female never received cervical screening until diagnosed with cervical cancer [20]. Identification and demonstration of cervical cancer related clinical oncoprotein will be useful for the cervical cancer screening/prevention. As a oncoprotein, PRMT5 that participated in the regulation of cell proliferation, tumorigenesis, tumor invasion and metastasis has been elucidated in many human cancers [21]. For instance, PRMT5 recruits WDR5, one member of MLL-complex, on the promoter of genes, which leading to generation and metastasis of breast cancer stem cells [22]. A recent study reported that PRMT5 disruption drives antitumor immunity in cervical cancer by reprogramming T cell-mediated response and regulating PD-L1 expression [23]. In this study, we found that PRMT5 expression was increased in the cervical cancer based on the RNA-expression profile in TCGA and GTEx database. Patients with high expression of PRMT5 are always associated with poor prognosis. Furthermore, we also demonstrated that PRMT5 was significantly overexpressed in the cervical cancer tissues via IHC and western blot assays. Above data shown that PRMT5 may acts as a oncoprotein in cervical cancer development. As a serine/threonine kinase, Akt is central component in the PI3K signaling pathway. Aberrant PI3K/Akt signaling pathway activity is frequently observed in many kinds of cancers [24]. Akt was activated by a wide range of growth signals and the biochemical mechanisms modulates numerous processes involved in cellular survival, proliferation, migration, metabolism, and angiogenesis via the downstream proteins [25]. For example, Lysosome activates AKT inducing cancer and metastasis [26]. A study in bladder urothelial cancer has shown that the suppression of PRMT5 significantly downregulated expression of PI3K and deactivated AKT [27]. Recently, it was reported that PRMT5 enhance the growth of human lung cancer cells through co-locates with Akt and modulates Akt activation [28]. In our study, we proved that PRMT5 facilitated cervical cancer cells colon formation and AKT phosphorylation. More importantly, our results also uncover that PRMT5 promotes cell survival in cervical cells via Akt activation. This study points to a clear relationship between PRMT5 and AKT activation in generation of cervical cancer, and further suggest that use of PRMT5 inhibitors may be potential to prevent cervical cancer progression.

Conflicts of Interest

All authors have completed the ICMJE uniform disclosure form. The authors have no conflicts of interest to declare.

Author Contribution

Enlin Wang performed the bioinformatics analysis. Xiaofeng Ma designed research and performed the experiments. Lei Zhan and Shiying Sun wrote the manuscript. Yurong Song and Qingyuan Wang collected the samples used for IHC. Bing Wei help us with language polish. All authors have read and agreed to the published version of the manuscript.

Acknowledgements

This study was supported by the Science Foundation of Anhui medical University (grant no. 2020xkj027).

References

  1. Arbyn M, Weiderpass E, Bruni L, et al. Estimates of incidence and mortality of cervical cancer in 2018: a worldwide analysis. The Lancet Global health 8 (2020): e191-e203.
  2. Akinyemiju TF. Socio-economic and health access determinants of breast and cervical cancer screening in low-income countries: analysis of the World Health Survey. PloS one 7 (2012): e48834.
  3. Buskwofie A, David-West G, Clare CA. A Review of Cervical Cancer: Incidence and Disparities. J Natl Med Assoc 112 (2020): 229-232.
  4. Hu Z, Ma D. The precision prevention and therapy of HPV-related cervical cancer: new concepts and clinical implications. Cancer Med 7 (2018): 5217-5236.
  5. Stopa N, Krebs JE, Shechter D. The PRMT5 arginine methyltransferase: many roles in development, cancer and beyond. Cellular and molecular life sciences : CMLS 72 (2015): 2041-2059.
  6. Kanou A, Kako K, Hirota K, et al. PRMT-5 converts monomethylarginines into symmetrical dimethylarginines in Caenorhabditis elegans. Journal of biochemistry 161 (2017): 231-235.
  7. Cho EC, Zheng S, Munro S, et al: Arginine methylation controls growth regulation by E2F-1. The EMBO journal 31 (2012): 1785-1797.
  8. Jiramongkol Y, Lam EW. FOXO transcription factor family in cancer and metastasis. Cancer Metastasis Rev 39 (2020): 681-709.
  9. Hughes AL, Kelley JR, Klose RJ. Understanding the interplay between CpG island-associated gene promoters and H3K4 methylation. Biochimica et biophysica acta Gene regulatory mechanisms 1863 (2020): 194567.
  10. Wang Q, Liang N, Yang T, et al. DNMT1-mediated methylation of BEX1 regulates stemness and tumorigenicity in liver cancer. J Hepatol 75 (2021): 1142-1153.
  11. Tarighat SS, Santhanam R, Frankhouser D, et al. The dual epigenetic role of PRMT5 in acute myeloid leukemia: gene activation and repression via histone arginine methylation. Leukemia 30 (2016): 789-799.
  12. Karkhanis V, Alinari L, Ozer HG, et al. Protein arginine methyltransferase 5 represses tumor suppressor miRNAs that down-regulate CYCLIN D1 and c-MYC expression in aggressive B-cell lymphoma. The Journal of biological chemistry 295 (2020): 1165-1180.
  13. Chen YR, Li HN, Zhang LJ, et al. Protein Arginine Methyltransferase 5 Promotes Esophageal Squamous Cell Carcinoma Proliferation and Metastasis via LKB1/AMPK/mTOR Signaling Pathway. Front Bioeng Biotechnol 9 (2021): 645375.
  14. Kim H, Kim H, Feng Y, et al. PRMT5 control of cGAS/STING and NLRC5 pathways defines melanoma response to antitumor immunity. Science translational medicine 12 (2020).
  15. Wang X, Qiu T, Wu Y, et al. Arginine methyltransferase PRMT5 methylates and stabilizes KLF5 via decreasing its phosphorylation and ubiquitination to promote basal-like breast cancer. Cell Death Differ 28 (2021): 2931-2945.
  16. Beketova E, Owens JL, Asberry AM, et al. PRMT5: a putative oncogene and therapeutic target in prostate cancer. Cancer Gene Ther 29 (2022): 264-276.
  17. Yokoi E, Mabuchi S, Takahashi R, et al. Impact of histological subtype on survival in patients with locally advanced cervical cancer that were treated with definitive radiotherapy: adenocarcinoma/adenosquamous carcinoma versus squamous cell carcinoma. J Gynecol Oncol 28 (2017): e19.
  18. Yin S, Liu L, Brobbey C, et al. PRMT5-mediated arginine methylation activates AKT kinase to govern tumorigenesis. Nature communications 12 (2021): 3444.
  19. Pimple SA, Mishra GA. Global strategies for cervical cancer prevention and screening. Minerva Ginecol 71 (2019): 313-320.
  20. Wuerthner BA, Avila-Wallace M. Cervical cancer: Screening, management, and prevention. Nurse Pract 41 (2016): 18-23.
  21. Kim H, Ronai ZA. PRMT5 function and targeting in cancer. Cell stress 4 (2020): 199-215.
  22. Chiang K, Zielinska AE, Shaaban AM, et al. PRMT5 Is a Critical Regulator of Breast Cancer Stem Cell Function via Histone Methylation and FOXP1 Expression. Cell reports 21 (2017): 3498-3513.
  23. Jiang Y, Yuan Y, Chen M, et al. PRMT5 disruption drives antitumor immunity in cervical cancer by reprogramming T cell-mediated response and regulating PD-L1 expression. Theranostics 11 (2021): 9162-9176.
  24. Song M, Bode AM, Dong Z, et al. AKT as a Therapeutic Target for Cancer. Cancer research 79 (2019): 1019-1031.
  25. Revathidevi S, Munirajan AK. Akt in cancer: Mediator and more. Semin Cancer Biol 59 (2019): 80-91.
  26. Radisavljevic Z. Lysosome activates AKT inducing cancer and metastasis. Journal of cellular biochemistry 120 (2019): 12123-12127.
  27. Tan L, Xiao K, Ye Y, et al. High PRMT5 expression is associated with poor overall survival and tumor progression in bladder cancer. Aging 12 (2020): 8728-8741.
  28. Yan Y, Zhao P, Wang Z, et al. PRMT5 regulates colorectal cancer cell growth and EMT via EGFR/Akt/GSK3beta signaling cascades. Aging 13 (2021): 4468-4481.
Article Views
2,891
Total Views
Download PDF
Article Details
  • Volume5
  • Issue4
  • Pages240–246
  • Published03 Nov 2022
  • ISSN2644-2884
  • DOI10.26502/fjwhd.2644-28840095
Journal

Journal of Womens Health and Development

Impact Factor: 3.4
Submit Manuscript
© 2016–2026, Copyrights Fortune Journals. All Rights Reserved.