Fortune Journals

Journal of Womens Health and Development

ISSN: 2644-2884 Peer Reviewed Open Access
Submit Manuscript →

Maternal TCN1 (rs526934) G>A Gene Polymorphism and its Association with Congenital Heart Disease (CHD)

Vol 3, Issue 4 Pages 432–436 Published: 28 Oct 2020

Sunitha Tella1*, Shehnaz Sultana1, Venkateshwari Ananthapur1, Nageshwar Rao K2, Jyothy Akka1, Satyanarayana U3

1Institute of Genetics and Hospital for Genetic Diseases, Osmania University, Telangana, India

2Care Hospital, Banjara Hills, Telangana, India

3Dr. Pinnamaneni Siddhartha Institute of Medical Sciences and Research Foundation, Gannavaram, India

*Corresponding author: Dr. Sunitha Tella, Institute of Genetics and Hospital for Genetic Diseases, Osmania University, Begumpet Hyderabad-500016, Telangana, India

Received: 05 October 2020; Accepted: 13 October 2020; Published: 28 October 2020

Article Information
Citation: Sunitha Tella, Shehnaz Sultana, Venkateshwari Ananthapur, Nageshwar Rao K, Jyothy Akka, Satyanarayana U. Maternal TCN1 (rs526934) G>A Gene Polymorphism and its Association with Congenital Heart Disease (CHD). Journal of Women’s Health and Development 3 (2020): 432-436.

DOI: 10.26502/fjwhd.2644-28840051

Share
Abstract

Background: Congenital heart diseases (CHDs) represent the most common birth defect, affecting 0.6–9.1 per 1000 live births, and the leading cause of infant deaths worldwide. Genes involved in vitamin B12 metabolism such as TCN1 may affect the balance of folate metabolism and ultimately contribute to the development of CHD through the disrupted folate metabolism pathway.

Methods: A total of 100 pregnant women carrying foetus with congenital heart defects are considered as case group and an equal number of healthy pregnant women carrying healthy foetus devoid of any defects are considered as control group for the present study. Blood samples were collected from all the study subjects. DNA was extracted and genotyping of TCN1 intron 372 G>A (rs526934) polymorphism was carried out using allele specific PCR, followed by agarose gel electrophoresis.

Results: Pregnant women in patient group, with GA genotype has 1.95 times more risk of having foetus with CHD compared to controls. Whereas, GG genotype played a protective role. ‘A’ allele was 2.14 times susceptible towards the disease, while ‘G’ allele showed protective effect.

Conclusion: Understanding the possible underlying genetic factors of vitamin B12 metabolism will lead to an increased understanding of the biological mechanisms underlying the maternal TCN1 gene polymorphism effect on CHD. This helps in early diagnosis, management and provide appropriate therapeutic strategies.

Keywords

Congenital Heart Disease, Transcobalamin, Single Nucleotide Polymorphism, Vitamin B12

Congenital Heart Disease articles; Transcobalamin articles; Single Nucleotide Polymorphism ; Vitamin B12 articles
Article Details

1. Introduction

Congenital heart diseases (CHDs) represent the most common birth defect, affecting 0.6–9.1 per 1000 live births, and the leading cause of infant deaths worldwide [1]. Several studies suggested that the interaction of genetic and environmental factors contributed to the increasing risk of CHDs [2-4]. Earlier studies showed that the folate metabolism pathway is involved in the development of CHD. Peri-conceptual folic acid supplementation could prevent fetal CHD, and folate deficiency in a pregnant woman potentially contributes to CHD in the developing embryo [5, 6]. Vitamin B12, or cobalamin, plays an important role in folate metabolism, in the form of methyl cobalamin, it participates in the folate-dependent methylation of homocysteine to form methionine in the presence of the enzyme methionine synthase. Therefore, vitamin B12 levels and the genes involved in vitamin B12 metabolism may affect the balance of folate metabolism and ultimately contribute to the development of CHD through the disrupted folate metabolism pathway. The transcobalamin 1 (TCN1) gene is located on chromosome 11 and codes for the vitamin B12 binding protein, transcobalamin I (TCI) also known as haptocorrin (HC) or R binder [7-9]. TCI is involved in facilitating the entry of vitamin B12 into the cells, via receptor mediated endocytosis [10]. Several studies have reported associations between variants within the TCN1 gene and circulating vitamin B12 concentrations [11-16]. In the present study, we hypothesized that the maternal TCN1 gene polymorphism may play a role in the aetiology of congenital heart disease (CHD).

2. Materials and Methods

2.1 Subjects

The present study consists of a total number of 200 samples. 100 pregnant women carrying foetus with congenital heart defects are considered as case group, whereas, 100 healthy pregnant women carrying healthy foetus devoid of any defects are considered as control group. The study subjects were enrolled from Government Modern Maternity Hospital, Care Hospital and Asian Institute of Fetal Medicine Hyderabad. The study subjects were screened for the foetal anomalies by a fetal medicine specialist and paediatric cardiologist by 3D/4D ultrasound. Prior informed consent was obtained from all the study subjects. Institutional ethical committee has approved the present study.

2.2 Genotyping

2ml of venous blood was collected from all the study subjects. Genomic DNA was isolated following the method of Lahiri et al [17] and genotyping of TCN1 intron 372 G>A (rs526934) polymorphism was carried out using allele specific PCR. The primers used for genotyping are WRP (TCATGCATTGAATTTCAGGG), MRP (TCATGCATTGAATTTCAGGA) and CFP (ATAGATTGTGTATTCACTTGCC). The amplified 198bp product was detected using agarose gel electrophoresis. Statistical analysis of the data was done by using Epi info online software. P value >0.05 was considered significant.

TCN1 rs526934

G>A

Patients

Controls

OR (95% CI)

P-value

No.

%

No.

%

Genotype

GG

36

33.03

58

58

0.35(0.20-0.62)

0.0002

GA

51

46.79

31

31

1.95(1.10-3.44)

0.0195

AA

22

20.18

11

11

2.04(0.93-4.47)

0.0689

Allele

G

123

56.42

147

73.5

0.46(0.30-0.70)

0.0002

A

95

43.58

53

26.5

2.14(1.41-3.23)

0.0002

Table 1: Genotyping of TCN1 (rs526934) in patients and controls group.

3. Results

Genotyping of TCN1 (rs526934) polymorphism in case and control women were shown in Table 1. Pregnant women in patient group, with GA genotype has 1.95 times more risk of having foetus with CHD compared to controls.  Whereas, GG genotype played a protective role. ‘A’ allele was 2.14 times susceptible towards the disease, while ‘G’ allele showed protective effect.

4. Discussion

Genetic studies carried out on vitamin B12, suggest that it is a multifactorial trait, where several single-nucleotide polymorphisms (SNPs)in multiple genes interact with the environment to cause the altered B12 status [18]. Most of the SNPs related to vitamin B12 status have been examined using a candidate gene approach [18]. Vitamin B12, also known as cobalamin (Cbl), is an essential water-soluble micronutrient required to be ingested by pregnant women to maintain a healthy foetus. It is important to maintain adequate vitamin B12 levels during pregnancy, for which pregnant women must ingest sufficient dietary vitamin B12 and retain the ability to absorb vitamin B12. The absorption, transport and cellular uptake of vitamin B12 is dependent upon the co-ordinated action of the binding proteins such as haptocorrin (HC), intrinsic factor (IF), transcobalamin II (TC) and other specific cell receptors. Initially vitamin B12 binds to HC in the stomach and IF in the duodenum, then it binds to TC within the enterocyte and is then released into the blood stream. The vitamin B12-TC complex then binds to the transcobalamin receptor (TC-R) and is taken up by cells through endocytosis [19]. Transcobalamin I (TCI) also known as haptocorrin is one of the cobalamin binding protein in humans. TCN1 gene is located on chromosome11q11-q12.3 [7], has 9 exons of 59 to 191 bp and 8 introns of 160 bp to 3.2 kb, and encodes a protein of 433amino acids [9]. Variants of the transcobalamin 1 (TCN1) gene (vitamin B12 binding protein, transcobalamin I (TCI)) have been associated with circulating B12 concentrations [8, 20]. Proteins involved in vitamin B12 absorption, cellular uptake and intracellular metabolism are affected by genetic variants, which in turn alters the vitamin B12 status [21]. In spite of a number of genome-wide association studies and candidate gene analyses, the exact relationship between an individual’s genotype and their vitamin B12 status remains poorly understood.

A Genome wide association study (GWAS) comprising 534 healthy children from Mysore, India, investigated the association between several nucleotide variations within the TCN1gene and vitamin B12 levels. Carriers of the‘G’ allele of the rs526934 variant were found to have lower circulating vitamin B12 concentrations (β = − 0.16 pmol/l,P = 0.02) compared to ‘A’ allele carriers [16], which were in consistent with the  studies carried out in Chinese, Icelandic, Italian and individuals residing in the US (predominantly non-Hispanic white) [13-15, 17]. Although no functional data are available to confirm the functional effect of these SNPs on vitamin B12concentrations, the results from these studies suggest that the SNPs may have important role of the TCN1 protein in maintaining vitamin B12 levels. The present study showed that pregnant women in patient group, with GA genotype has 1.95 times more risk of having foetus with CHD compared to controls.  While, GG genotype played a protective role. ‘A’ allele was 2.14 times susceptible towards the disease, and ‘G’ allele showed protective effect. The study results indicate that more studies are needed to elucidate the mechanism of maternal genetic factors in CHDs.

5. Conclusion

Understanding the possible underlying genetic factors of vitamin B12 metabolism will lead to an increased understanding of the biological mechanisms underlying the maternal TCN1 gene polymorphism effect on CHD. The study may also help in early diagnosis, management and provide appropriate therapeutic strategies.

Conflict of Interest

None to declare

References

  1. Denise van der Linde, Elisabeth E M Konings, Maarten A Slager, Maarten Witsenburg, Willem A Helbing, Johanna J M Takkenberg, et al. Birth prevalence of congenital heart disease worldwide: a systematic review and meta-analysis. Journal of the American College of Cardiology 58 (2011): 2241-2247.
  2. Hobbs C A, Cleves M A, Karim M A, Zhao W, MacLeod S L. Maternal folate-related gene environment interactions and congenital heart defects. Obstetrics and gynecology 116 (2010): 316-322.
  3. Vecoli C, Pulignani S, Foffa I, Andreassi M G. Congenital heart disease: the crossroads of genetics, epigenetics and environment. Current genomics 15 (2014): 390-399.
  4. Hui Shi, Shiwei Yang, Yan Liu, Peng Huang, Ning Lin, Xiaoru Sun, et al. Study on Environmental Causes and SNPs of MTHFR, MS and CBS Genes Related to Congenital Heart Disease. PloS one 10 (2015): e0128646.
  5. Botto LD, Mulinare J, Erickson JD. Do multivitamin or folic acid supplements reduce the risk for congenital heart defects? Evidence and gaps. Am J Med Genet A 121 (2003): 95-101.
  6. Bailey LB, Berry RJ. Folic acid supplementation and the occurrence of congenital heart defects, orofacial clefts, multiple births, and miscarriage. Am J Clin Nutr 81 (2005): 1213-1217S.
  7. Shows TB. Report of the fifth international workshop on human chromosome 11 mapping 1996. Cytogenet Cell Genet 74 (1996): 1-56.
  8. Jennifer Johnston, Jacques Bollekens, Robert H AIlenl, Nancy Berliner, et al. Structure of the cDNA encoding transcobalamin I, a neutrophil granule protein. J Biol Chem 264 (1989): 15754-15757.
  9. Johnston J, Yang-Feng T, Berliner N. Genomic structure and mapping of the chromosomal gene for transcobalamin I (TCN1): comparison to human intrinsic factor. Genomics 12 (1992): 459-464.
  10. Seetharam B. Receptor-mediated endocytosis of cobalamin (vitamin B12). Annu Rev Nutr 19 (1999): 173-195.
  11. Niels Grarup, Patrick Sulem, Camilla H Sandholt, Gudmar Thorleifsson, Tarunveer S Ahluwalia, Valgerdur Steinthorsdottir, et al. Genetic architecture of vitamin B12 and folate levels uncovered applying deeply sequenced large datasets. PLoS Genet 9 (2013): e1003530.
  12. Zinck JW, de Groh M, MacFarlane AJ. Genetic modifiers of folate, vitamin B-12, and homocysteine status in a cross-sectional study of the Canadian population. Am J Clin Nutr 101 (2015): 1295-1304.
  13. Xiaoling Lin, Daru Lu, Yong Gao, Sha Tao, Xiaobo Yang, Junjie Feng, et al. Genome-wide association study identifies novel loci associated with serum level of vitamin B12 in Chinese men. Hum Mol Genet 21 (2012): 2610-2617.
  14. Aditi Hazra, Peter Kraft, Ross Lazarus, Constance Chen, Stephen J Chanock, Paul Jacques, et al. Genome-wide significant predictors of metabolites in the one-carbon metabolism pathway. Hum Mol Genet 18 (2009): 4677-4687.
  15. Toshiko Tanaka, Paul Scheet, Betti Giusti, Stefania Bandinelli, Maria Grazia Piras, Gianluca Usala, et al. Genome-wide association study of vitamin B6, vitamin B12, folate, and homocysteine blood concentrations. Am J Hum Genet 84 (2009): 477-482.
  16. Suraj S Nongmaithem, Charudatta V Joglekar, Ghattu V Krishnaveni, Sirazul A Sahariah, Meraj Ahmad, Swetha Ramachandran, et al. GWAS identifies population specific new regulatory variants in FUT6 associated with plasma B12 concentrations in Indians. Hum Mol Genet 26 (2017): 2551-2564.
  17. Lahiri K Debomoy, Nurnberger I John. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Research 19 (1991): 5444.
  18. Haggarty P. B-vitamins, genotype and disease causality. Proc Nutr Soc (2007): 539-547.
  19. Das D, Haloi A. Vitamin B12 gene polymorphisms and chronic diseases. J Nutr Disord 4 (2014): 149.
  20. Surendran S, Adaikalakoteswari A, Saravanan P, Shatwaan I A, Lovegrove J A, Vimaleswaran K S. An update on vitamin B12-related gene polymorphisms and B12 status. Genes Nutr 13 (2018): 2.
  21. Quadros EV. Advances in the understanding of cobalamin assimilation and metabolism. Br J Haematol 148 (2010): 195-204.
Article Views
2,589
Total Views
Download PDF
Article Details
  • Volume3
  • Issue4
  • Pages432–436
  • Published28 Oct 2020
  • ISSN2644-2884
  • DOI10.26502/fjwhd.2644-28840051
Journal

Journal of Womens Health and Development

Impact Factor: 3.4
Submit Manuscript
© 2016–2026, Copyrights Fortune Journals. All Rights Reserved.