Adrian P. Mansini1,5, Claus Meyer 4, Marta Gallego2, Patricia L. Rubio1, Adriana Medina1, Mariela Coccé2, Jorge Rossi3, Pedro Zubizarreta1, Rolf Marschalek4, Maria Sara Felice1, Cristina N. Alonso1
1Department of Hematology-Oncology, Hospital De Pediatría Prof. Dr. Juan P. Garrahan, Buenos Aires, Argentina
2Cytogenetics Laboratory, Genetics Department, Rush University, USA.
3Immunology and Rheumatology Department, Hospital de Pediatría "Prof. Dr. Juan P. Garrahan".
4Institute of Pharmaceutical Biology/Diagnostic Center of Acute Leukemia (DCAL), Goethe-University, Frankfurt/Main, Germany.
5Department of Urology, Rush University
*Corresponding author: Adrian P. Mansini, Department of Urology, Rush University Medical Center,
RUSH University, 1735 W. Harrison St. 60612.
Received: 19 October 2023; Accepted: 31 October 2023; Published: 06 December 2023
Translocations involving the Mixed Lineage Leukemia (MLL) gene can be detected in de novo acute lymphoblastic leukemia (ALL), acute myeloblastic leukemia (AML), therapy-related acute leukemias, and are highly associated with infant acute leukemia. Analysis of these genetic rearrangements is required for stratifying patients into risk groups for treatment tailoring in current protocols. Their occurrence usually predicts a poor outcome. We report the biological and molecular characteristics of 34 pediatric acute leukemia cases with MLL rearrangements. Samples were further analyzed by LDI-PCR to characterize the respective fusion partner genes. AFF1 was the main partner gene in ALL, while MLLT10 was predominantly identified in AML in this series. Although RT-PCR allowed quick detection of most cases with MLL gene rearrangements, the routinely performed cytogenetic analysis combined with LDI-PCR was a powerful tool for accurate diagnosis and subsequent tailoring of treatment.
MLL, LDI-PCR, infant acute leukemia, fusion genes
MLL articles, LDI-PCR articles, infant acute leukemia articles, fusion genes articles
Translocations involving the Mixed Lineage Leukemia gene (MLL, also known as Lysine-specific methyltransferase 2A, KMT2A), can be detected in de novo acute lymphoblastic leukemia (ALL), acute myeloblastic leukemia (AML) and therapy-related acute leukemia. The occurrence of abnormalities in the MLL gene, located on chromosome 11q23, is observed in more than 80% of infant ALL and more than 50% of infant AML cases [1-4] and most likely confers a poor prognosis for these patients [3, 5, 6]. At least 100 MLL rearrangements have been reported, of which 79 have been characterized at the molecular level [7-9]. MLL/11q23 aberrations can be analyzed by G-banding, fluorescence in situ hybridization (FISH), reverse transcription followed by polymerase chain reaction (RT-PCR), or Long-Distance Inverse PCR (LDI-PCR), among others. Each technique has advantages and disadvantages but are complementary for accurately characterizing MLL alterations. LDI-PCR allows the detection of MLL rearrangements, specifically in cases where the fusion partner gene is yet unknown and improves the detection rate of MLL rearrangements [10]. Besides, the established DNA sequences of the fusion region of MLL rearrangements at the genomic level can be used as targets for Minimal Residual Disease (MRD) quantification [11]. Here, we report the characterization of MLL rearrangements by LDI-PCR in 34 pediatric patients from a single center in Argentina and describe cases in which discordances were found between results obtained by cytogenetics, RT-PCR and/or LDI-PCR.
2.1 Sample collection
Bone marrow samples from 34 de novo acute leukemia cases with MLL rearrangements were characterized by LDI-PCR. Twenty-nine patients were younger than 1 year (infants). Five pediatric non-infant cases were included in the analysis by LDI-PCR due to the presence of MLL/11q23 abnormalities detected by G-banding or FISH analyses. Immunophenotype of blasts was characterized in all cases according to standardized procedures described previously [12], and acute leukemia cases were classified according to the WHO 2008 definitions [13].
2.2 Conventional cytogenetics and Fluorescent in situ hybridization (FISH)
Chromosome G-banding analyses were performed by standard methods. Karyotypes were described according to the International System for Human Cytogenetic Nomenclature [14]. FISH analysis for MLL rearrangements was performed using the LSI MLL Dual-Color, Break-Apart Probe, according to the manufacturer’s instructions (Vysis, Abbott Molecular Inc., Des Plaines, IL, USA).
2.3 RT-PCR
RT-PCR was performed following the Biomed-1 protocol [15]. Samples from infant patients were routinely analyzed for the presence of MLL-MLLT1, MLL-AFF1, and MLL-MLLT3 fusion transcripts using primers and procedures described previously [15, 16]. The presence of MLL-MLLT10, MLL-MLLT11, MLL-MLLT6, MLL-MLLT4, and MLL-BTBD18 fusion transcripts was investigated using oligonucleotide MLL-A [15] as forward primer and the corresponding reverse oligonucleotides designed according to expected cleavage sites detected by LDI-PCR. Sequences of the oligonucleotides are available as supplementary material S1. The integrity and amplificability of samples were evaluated using the ABL1 transcript as the control gene [16].
2.4 Long-distance inverse-polymerase chain reaction (LDI-PCR)
LDI-PCR was performed as previously described [10]. Briefly, 1 μg of genomic DNA was digested with restriction enzymes and re-ligated to form DNA circles before LDI-PCR using MLL-specific primers. Restriction polymorphic PCR amplimers were isolated from agarose gels and subjected to DNA sequence analysis to obtain the patient-specific fusion sequences. Unknown sequences were characterized using the human genome database (BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi).
3.1 Patient characterization
Clinical and hematological characteristics of the 34 cases are described in Table 1. Extramedullar compromise was observed in 14 cases (41%). The mean white blood cell (WBC) count was 190,100/mm3 (range:2,100-760,000/mm3), and hyperleukocytosis (>100,000/mm3) was detected in 53% of cases. Diagnoses of these 34 cases were 20 ALL, 12 AML, and 2 ambiguous lineages acute leukemias (ALAL). ALL phenotype was Pro-B in 50% of cases; all AML cases were monoblastic FAB-subtype, while both ALAL cases disclosed mixed Myeloid–B phenotype (Table 2). Infants with ALL diagnoses were treated according to the Interfant-99 protocol [3]. ALL patients older than 1 year were treated according to the ALLIC-protocol [17]. Children diagnosed with AML received local BFM-based protocol (BFM) [18]. ALAL cases were treated according to the AML protocol based on the predominant myeloid blast population. Complete remission (CR) was achieved in 31 (91%) cases. In comparison, 2 patients died during the induction phase (6%), and 1 T-ALL patient did not respond to induction therapy at day 33, albeit showing a late response. Of the 32 patients (including the late responder) who achieved CR, 14 patients relapsed with a median of 11 (range: 3-64) months, 1 case developed a lineage switch, 6 patients died in CR, and 11 patients remained in continuous CR with a median follow up of 67 (38-121) months (Table 2).
Table 1: Clinical and hematological characteristics of the 34 patients with acute leukemia.
|
CASE # |
AGE |
SEX |
WBC (x103/mm3) |
Hb (g/dI) |
Plat (x109/L) |
HEP |
SP |
EXTRAMEDULLAR |
|
1 |
3 m |
F |
6.9 |
9.3 |
315 |
No |
Yes |
skin |
|
2 |
2 m |
M |
550 |
7.7 |
30 |
No |
No |
Abdomen/ganglio |
|
3 |
3 m |
M |
25 |
8 |
181 |
No |
No |
No |
|
4 |
4 m |
F |
291 |
6.7 |
14 |
Yes |
Yes |
No |
|
5 |
9 m |
M |
16 |
12.3 |
40 |
Yes |
No |
No |
|
6 |
3 m |
F |
204 |
10 |
30 |
Yes |
Yes |
No |
|
7 |
0.1 m |
F |
90 |
8 |
12 |
No |
Yes |
No |
|
8 |
8 m |
M |
240 |
6 |
24 |
Yes |
Yes |
No |
|
9 |
8 m |
M |
11 |
7.2 |
104 |
No |
Yes |
Skin |
|
10 |
4 m |
F |
136 |
7.7 |
33 |
No |
Yes |
No |
|
11 |
4.8 a |
M |
526 |
5 |
25 |
No |
No |
No |
|
12 |
7 m |
M |
22.8 |
10.3 |
10 |
No |
No |
No |
|
13 |
5 m |
F |
470 |
11 |
15 |
Yes |
Yes |
Kidney |
|
14 |
4 m |
F |
700 |
9.9 |
88 |
Yes |
Yes |
CNS |
|
15 |
2.3 a |
F |
4.1 |
4.4 |
213 |
Yes |
Yes |
No |
|
16 |
1 m |
F |
249 |
9.1 |
30 |
No |
Yes |
Skin |
|
17 |
2 m |
F |
300 |
6.8 |
10 |
Yes |
No |
No |
|
18 |
11 m |
F |
75.8 |
7.6 |
42 |
Yes |
Yes |
No |
|
19 |
3 m |
F |
13 |
5.1 |
74 |
Yes |
Yes |
No |
|
20 |
3 m |
F |
13.5 |
6.6 |
14 |
Yes |
Yes |
No |
|
21 |
0.11 m |
F |
142 |
6.8 |
43 |
Yes |
Yes |
CNS, Kidney |
|
22 |
8 m |
F |
217 |
6.4 |
67 |
Yes |
Yes |
No |
|
23 |
11 m |
F |
217 |
7.4 |
135 |
Yes |
Yes |
Skin |
|
24 |
3 m |
M |
3.6 |
10 |
118 |
Yes |
Yes |
Skin |
|
25 |
2.8 y |
F |
3.8 |
7.9 |
27 |
Yes |
Yes |
Kidney |
|
26 |
2.1 y |
M |
43 |
8.3 |
138 |
Yes |
Yes |
No |
|
27 |
3 m |
F |
760 |
7.8 |
9 |
Yes |
Yes |
No |
|
28 |
9 m |
M |
2.1 |
6.3 |
4 |
Yes |
Yes |
Testis |
|
29 |
4 m |
M |
49.4 |
11.2 |
44 |
Yes |
Yes |
No |
|
30 |
6 m |
F |
282 |
4 |
37 |
Yes |
Yes |
No |
|
31 |
6 m |
F |
13.9 |
4.3 |
11 |
Yes |
Yes |
CNS |
|
32 |
4 m |
M |
212.6 |
6.5 |
51 |
Yes |
Yes |
No |
|
33 |
12 m |
M |
274 |
6.8 |
71 |
Yes |
Yes |
CNS, O, Kidney |
|
34 |
5 m |
M |
300 |
7.1 |
47 |
Yes |
Yes |
CNS, Skin |
M: male; F: female; y: years; m: months; WBC: White blood cells; Hb: hemoglobin; Plat: platelets; HEP: hepatomegaly; SP: Splenomegaly; CNS: Central Nervous System; O: orbit
Table 2: Immunophenotype, response to treatment and outcome of the 34 patients
|
CASE # |
Immunophenotype/ FAB subtype |
Induction response |
Outcome (months) |
|
1 |
FAB-M5 |
CR |
Relapsed (3) |
|
2 |
Pro-B |
CR |
CCR (+60) |
|
3 |
Pro-B |
CR |
Death in CR (6) |
|
4 |
Pre-B |
CR |
Relapsed (28) |
|
5 |
Pro-B |
CR |
Relapsed (5) |
|
6 |
FAB-M5 |
CR |
CCR (+108) |
|
7 |
Pro-B |
CR |
CCR (+121) |
|
8 |
Pro-B |
CR |
Relapsed (12) |
|
9 |
B Mature |
CR |
Relapsed (21) |
|
10 |
FAB-M5 |
CR |
Relapsed (15) |
|
11 |
Pro-B |
CR |
CCR (+61) |
|
12 |
Pre-B |
CR |
CCR (+71) |
|
13 |
Pre-B |
CR |
Relapsed (3) |
|
14 |
Pro-B |
CR |
Relapsed (1) |
|
15 |
FAB-M5 |
CR |
CCR (+87) |
|
16 |
Pre-B |
CR |
Relapsed (98) |
|
17 |
Pro-B |
CR |
Relapsed (9) |
|
18 |
ALAL (myeloid + B) |
CR |
Relapsed (6) |
|
19 |
Pre-B |
CR |
Death on CR (3) |
|
20 |
Pro-B |
CR |
Death on CR (1) |
|
21 |
ALAL (myeloid + B) |
CR |
Linage switch (1) |
|
22 |
FAB-M5 |
CR |
CCR (+67) |
|
23 |
FAB-M5 |
CR |
CCR (+66) |
|
24 |
FAB-M5 |
CR |
Death on RC (3) |
|
25 |
FAB-M5 |
CR |
CCR (+57) |
|
26 |
T |
Null response |
Death on RC (6) |
|
27 |
Pre-B |
CR |
Relapsed (4) |
|
28 |
FAB-M5 |
CR |
Relapsed (11) |
|
29 |
Pro-B |
Death |
- |
|
30 |
FAB-M5 |
CR |
CCR (+52) |
|
31 |
Pre-B |
CR |
Death on CR (1) |
|
32 |
FAB-M5 |
CR |
Relapsed (11) |
|
33 |
FAB-M5 |
Death |
- |
|
34 |
Pre-B |
CR |
CCR (+38) |
ALAL: acute leukemia of ambiguous lineage; CR: complete remission; CCR: Continuous complete remission.
3.2 Cytogenetic and FISH analyses
Cytogenetic studies were successful in 33 (97%) of 34 patients included in this cohort (Table 3). Abnormalities of the 11q23 region, suggesting an MLL involvement, were detected in 26 cases by G-banding. Following aberrations were found: t(4;11)(q21;q23) (n= 10), t(1;11)(q21;q23) (n= 3), t(11;19)(q23;p13) (n= 2), t(4;11;10)(q21;q23;q22) (n= 1), ins(11;4)(q23;q21q25) (n= 1), t(9;11)(p22;q23) (n= 1); inv(11)(q13q23) (n= 1), del(11)(q23) (n= 1), t(6;11)(q27;q23) (n= 1), t(11;17)(q23;q21) (n= 1), t(11;22)(q23;q13) (n= 1), t(10;11)(p12;q23) (n= 1). Two cases had a complex karyotype, where one showed alterations of 11q23 and 19p13.3 regions but did not have the typical t(11;19), while the other showed alterations of 9p22 and 11q23 regions. FISH analysis was performed for 21 cases, and the result disclosed a split signal in 20 of them, two with normal karyotypes and three with abnormal karyotypes not involving 11q23. Among the latter, one case disclosed a t(9;10)(q32;p11.2), and FISH revealed a cryptic insertion of the 5’MLL gene into the derivative chromosome 10. Another case showed a t(10;22;11)(p13;q11.2;q13) and FISH revealed MLL rearrangement with 5’MLL signal on 10p12. Finally, one case with del(1)(q21), add(10)(p11),-11 in which the split FISH study showed a split signal. In 1 case, the karyotype result was normal, and FISH did not show a split signal.
Table 3: Results of cytogenetic and molecular cytogenetic studies of the 34 patients with Acute Leukemia
|
CASE # |
KARYOTYPE |
SPLIT-FISH |
|
1 |
46,XX[20] |
Positive |
|
2 |
46,XY,t(4;11)(q21;q23)[9]/46,XY[11] |
Not done |
|
3 |
46,XY,t(4;11;10)(q21;q23;q22),9ph[20] |
Positive |
|
4 |
46,XX,t(4;11)(q21;q23)[20] |
Not done |
|
5 |
46 XY,inv(11)(q13q23)[20] |
Positive |
|
6 |
46,XY,t(1;11)(q21;q23)[20] |
Positive |
|
7 |
46,XX,t(4;11)(q21;q23)[3]/46,XX[17] |
Not done |
|
8 |
46,XY,t(4;11)(q21;q23)[14]/46,XY[6] |
Positive |
|
9 |
46~48,XY,+11,del(11)(q23),add(19)(p13),+mar[cp20] |
Positive |
|
10 |
46,XX,t(10;22;11)(p13;q11.2;q13)[20] |
Positive |
|
11 |
46,XY,t(4;11)(q21;q23)[15]/46,XY[5] |
Not done |
|
12 |
46XY,t(11;22)(q23;q13),add(12)(p12)[6]/47,idem,+X[11]/46,XY[3] |
Positive |
|
13 |
46,XX,t(11;19)(q23;p13)[20] |
Positive |
|
14 |
46,XX,t(4;11)(q21;q23)[14]/46,XX[6] |
Positive |
|
15 |
46,XX,del(1)(q21),add(10)(p11),-11,+mar[6]/46,XX[14] |
Positive |
|
16 |
46,XX[20] |
Positive |
|
17 |
46,XX,t(4;11)(q21;q23)[10]/46,XX[10] |
Not done |
|
18 |
46,XX,t(11;19)(q23;p13)[14]/46,XX[6] |
Not done |
|
19 |
45,XX,t(4;11)(q21;q23),der(13;21)(q10;q10)[7]/46,XX [13] |
Positive |
|
20 |
46,XX t(4;11)(q21;q23)[15]/46,XX[5] |
Positive |
|
21 |
46,XX,ins(11;4)(q23;q21q25)[14]/46,XX[6] |
Not done |
|
22 |
46,XX,t(1;11)(q21;q23)[20] |
Not done |
|
23 |
46,XX[20] |
Positive |
|
24 |
46,XY[20] |
Negative |
|
25 |
46,XX,t(1;11)(q21;q23)[2]/48,idem,+8,+21[18] |
Not done |
|
26 |
46,XY,del(11)(q23)[4]/46,XY[11] |
Not done |
|
27 |
No methapases were obtained |
Not done |
|
28 |
46,XY,t(9;11)(p22;q23)[17]/46,XY[3] |
Not done |
|
29 |
46,XY,t(4;11)(q21;q23)[16]/46,XY[4] |
Not done |
|
30 |
46,XX,t(6;11)(q27;q23)[20] |
Positive |
|
31 |
46,XX,t(11;17)(q23;q21)[4]/46,XX[16] |
Positive |
|
32 |
46,XY,t(10;11)(p12;q23)[17]/46,XX[3] |
Positive |
|
33 |
46,XY,t(9;10)(q32;p11.2)[18]/46,XY[2] |
Positive |
|
34 |
46,XY, der(3)(9pter-->9p22::11q23-->11q23::3p21-->3qter),der(9)(11qter-->11q23::9p22-->9qter),der(11)(11pter-->11q23::3p21-->3pter)[19]/46,XY[1] |
Positive |
3.3 RT-PCR results
RT-PCR allowed the detection of MLL fusion transcripts in 33 (97%) of 34 cases (Table 4). Recurrent rearrangements found were AFF1 (n= 12), MLLT1 (n= 4), and MLLT3 (n= 3). Other partners were characterized by LDI-PCR and/or cytogenetic findings: MLLT10 (n= 7), MLLT11 (n= 3), MLLT4 (n= 2), MLLT6 (n= 1) and BTBD18 (n= 1). In case #19, the expected MLL-AFF1 fusion transcript was not detected.
3.4 LDI-PCR results
The identified MLL fusion partner genes (Table 4) detected by LDI-PCR on the derivative chromosome 11 were AFF1 (n= 12), MLLT10 (n= 6), MLLT1 (n= 4), MLLT3 (n= 3), MLLT11 (n= 3), MLLT4 (n= 2), BTBD18 (n= 1), and MLLT6 (n= 1). The fusion sequence on der11 (5´-3´) was detected in 32 of 34 cases. Only the reciprocal rearrangement could be detected in two cases, involving AFF1 in one case and SVIL in the other. In 4 cases, LDI-PCR allowed the detection of MLL abnormalities that other techniques did not show at diagnosis, including 3 cases with normal karyotype and no FISH results (cases #1, #23, and #24). RT-PCR confirmed LDI-PCR results for the MLL-MLLT10 fusion transcript. In 1 case with t(9;10) where G-banding did not detect 11q23 abnormality (case #31), LDI-PCR identified MLL-MLLT6 that RT-PCR and split-FISH later confirmed. MLL-MLLT1 rearrangement was detected in 4 patients, including the case with t(11;22)(q23;q13), add(12)(p12) detected by G-banding, which did not involve the 11q23 band. Three of them were spliced fusions, while in the other case, a 267 bp fragment of the NDUFA9 gene was detected between MLL intron 9 and MLLT1 intron 3 sequences (case #12). MLL-AFF1 rearrangement was detected in 13 cases, 12 of which had been detected by RT-PCR, including a case with normal karyotype. In the remaining case (case #19), in which G-banding resulted in 45, XX,t(4;11)(q21;q23),der(13;21)(q10;q10), the MLL-AFF1 transcript fusion was not detected by RT-PCR and neither by LDI-PCR. However, LDI-PCR detected the reciprocal fusion sequence between AFF1 intron 10 and MLL intron 8. MLL-MLLT3 was detected in 3 cases, 1 of whom showed a normal karyotype by G-banding. MLL-MLLT4 rearrangement was observed in 2 cases, 1 of which presented as the only abnormal deletion of the band 11q23 by G-banding. In 3 cases where LDI-PCR detected MLL-MLLT1 and MLL-MLLT6, the fusion transcripts were subsequently demonstrated by RT-PCR based on LDI-PCR results. According to G-banding results, MLL-BTBD18 rearrangement was detected via LDI-PCR from the genomic DNA of a patient with inv(11q23). Based on LDI-PCR results, the MLL-MLLT10 fusion transcript was searched and detected in 6 patients (5 AML and 1 ALL). In 5 of these cases, LDI-PCR detected rearrangement at the molecular level, while in a further case of ALL and normal karyotype, MLL-MLLT10 fusion transcript was detected by RT-PCR but not LDI-PCR. However, the reciprocal rearrangement involving the SVIL gene at chromosome 11p12 was detected by LDI-PCR.
Table 4: Results of molecular studies of 34 patients with Acute Leukemia
*Detection based on LDI-PCR results; PG: partner gene; SJ: spliced sequence before MLLT1 exon 1
We report the genetic characterization of MLL rearrangements in 34 acute leukemia pediatric patients diagnosed and treated at a single institution in Argentina. MLL translocations are present in up to 80% of infant ALL cases and 50% of infant AML cases [19-21]. The presence of MLL rearrangements is an independent dismal prognostic factor requiring individualized therapy [3]. Therefore, identifying MLL fusions is mandatory for determining the most accurate treatment. Several techniques have been used in diagnosis to characterize this particular group of patients genetically. LDI-PCR was the most helpful technique for this analysis since it allowed the detection of almost any MLL rearrangements, particularly in cases where standard karyotyping or RT-PCR analyses failed. Although split-FISH appears to be the most reliable method for detecting MLL rearrangement, false-negative results can occur, and split-FISH alone does not provide information on the translocation partner. Moreover, LDI-PCR can be used when FISH probes are not available. Indeed, LDI-PCR is laborious, time-consuming, and may not detect all rearrangements. Nonetheless, it is the only tool that provides a patient-specific DNA target that can be directly used for designing patient-specific oligonucleotides for MRD analyses, especially in infant cases that usually disclose immature B phenotype and lack Immunoglobulins and T-cell receptors (Ig/TCR) rearrangements [22]. In the present report, the MLL-AFF1 fusion gene was the predominant MLL aberration in infant ALL cases. In AML patients, MLL-MLLT10 was the most frequently detected fusion transcript, probably due to the limited number of patients. Detection of MLL-MLLT10 in our series allowed us to define the MLL status of one case with normal karyotype (case #24). Moreover, our findings led us to include MLL-MLLT10 in the initial RT-PCR screening of AML cases without any other demonstrable recurrent abnormalities.
We described a case (#26) with deletion of 11q23 by conventional cytogenetics that showed an MLL-MLLT4 fusion detected by LDI-PCR in a case not studied by FISH analysis. Two cases (#3 and #10) showed a three-way translocation, and in only one of them, it was possible to detect the 11q23 band alteration by conventional cytogenetics. However, in both cases, MLL abnormality was detected by split-FISH, RT-PCR, and LDI-PCR. Spliced fusions observed in two patients were generated by the genomic fusion of the 5'-MLL gene upstream of the MLLT1 gene. In both cases, RT-PCR detected functional MLL fusion mRNA in which the 5’MLL exon 11 was spliced to exon 2 of the MLLT1 gene. This is a well-described mechanism for MLL-MLLT1 fusions [7, 22]. MLL-MLLT3 is the most frequent rearrangement reported in AML. While limited in number, the high frequency of MLL-MLLT10 in our patients could be due to our focus on infants rather than pediatric patients. We neither found an association between the recombination site within MLL and the immunophenotype or maturation stage of the blasts. Four cases in our series showed a normal karyotype, while FISH analysis in two cases revealed split signals in interphase nuclei. This could be due to a cryptic chromosomal abnormality, a minimal neoplastic clone not detected by cytogenetics, or a failure for cells to reach metaphases from the leukemic cells.
Patients with MLL abnormalities generally have poor prognoses and are treated according to high-risk protocols [5, 23]. This agrees with our data since patients in this study had poor survival, regardless of being ALL or AML. Six percent of deaths occurred during the induction phase, and 18% died while in complete remission. This therapy-related mortality is probably related to the high intensity of administered chemotherapies for these particular groups of children. Fourteen patients relapsed, and 11 (32%) remain in continuous complete remission. As expected, no association was found between survival and fusion partner gene involved in rearrangements, in agreement with all MLL abnormalities conferring poor prognosis to these particular leukemia cases as stated by Interfant-99 results [3]. MRD quantification by real-time PCR using rearrangements of Ig/TCR as a molecular target is a powerful predictor of outcome in ALL. This helpful tool for MRD determination in most pediatric leukemias may not apply to infant ALL patients because these rearrangements are highly polyclonal and thus not optically suited for qPCR. Even more, the lack of Ig/TCR rearrangements or incomplete Ig/TCR rearrangements can occur. This may be due to the immaturity of MLL-rearranged leukemic blasts [24] and raises the chances that the Ig/TCR rearrangements could be edited or completed during treatment, leading to false negative results in MRD quantification. Characterizing the breakpoint region at the genomic level enables the design of patient-specific probes or primers that recognize the fusion sequence of the leukemic clone. Based on the high frequency of MLL rearrangements in the infant population, the fusion gene constitutes an excellent target for MRD monitoring since it is specific for the leukemic clone, stable over time, and allows MRD analysis in cases with undetectable Ig/TCR rearrangements.
We report the molecular characterization of 34 pediatric patients with acute leukemia and MLL gene rearrangements treated at a single institution in Argentina. According to our data, RT-PCR allowed the identification of most cases with MLL rearrangements but could not completely characterize all cases. LDI-PCR helped detect MLL gene rearrangements even when the partner gene was unknown or could not be detected by other techniques. This technique had a good correlation with different methods for detecting MLL abnormalities. The high frequency of MLL-MLLT10 rearrangements found in our AML population changed our diagnostic strategy since we incorporated MLL-MLLT10 rearrangements in our RT-PCR screening panel. Although LDI-PCR is not known to be a screening technique, it can be used for cases where MLL abnormalities are highly suspected. Additionally, LDI-PCR constitutes a valuable diagnostic tool when Split-FISH is not easily available; however, it may not detect MLL rearrangements in some cases due to limitations of the technology or chromosomal breakpoints located outside of the MLL breakpoint cluster region [10]. Our results highlight the importance of using different and complementary techniques to precisely diagnose pediatric acute leukemia patients. An accurate characterization of MLL alterations allows optimal risk stratification and application of the most appropriate treatment for each patient. Additionally, LDI-PCR enables patient-specific MRD monitoring to adapt the corresponding therapy - if necessary - in cases with sub-optimal response to treatment or early relapse detection.
No Conflict Statement
All authors have participated in the planning, execution, and analysis of the study and have approved this version. The authors declare no potential conflicts of interest.
Adrian P. Mansini was supported by Grant PICT2007-01723 from the Agencia Nacional de Promoción Científica y Tecnológica, Ministeriode CienciayTecnologíadelaNación.
Sequences of the oligonucleotides for detection of fusion transcripts by RT-PCR: MLL-MLLT10, MLL-MLLT11, MLL-MLLT6, MLL-MLLT4 and MLL-BTBD18
|
Primer |
Complementary sequence |
Sequence (5' à 3') |
|
|
MLL-A |
Fw |
MLL exon 8 |
CCGCCTCAGCCACCTAC |
|
AF10-A |
Rv |
MLLT10 exon 9 |
TGGACATTATCGGCACCATTAC |
|
AF10-B |
Rv |
MLLT10 exon 12 |
TTGCCCTCTGACCCTCTAGTCT |
|
BTBD18 |
Rv |
BTBD18 exon 3 |
GCACTTGTTGGTTGTAAGCACT |
|
MLLT4-ex2 |
Rv |
MLLT4 exon 2 |
AGGACAGCATTCGCATATCAG |
|
MLLT6-ex7 |
Rv |
MLLT6 exon 7 |
AGATGAAACCACTGCCACCTC |
|
MLLT11-ex2 |
Rv |
MLLT11 exon 2 |
AGCTCCGACAGATCCAGTTCT |