Fortune Journals

Archives of Microbiology & Immunology

ISSN: 2572-9365 Peer Reviewed Open Access
Submit Manuscript →

Optimizing the Effects of Dietary Tridax Procumbens leaf Extract on Growth Performance, Antioxidant Activity, Immune Response, and Disease Resistance Against Aeromonas Hydrophila in Labeo rohita

Vol 9, Issue 2 Pages 141–157 Published: 30 Apr 2025

Shweta Priyadarshini Dash1, Sasmita Mohanty1, B Prince1, Pushpa Choudhary*, 1, Chinmayee Muduli*, 1, Arabinda Das2, Priyabrat Swain1, Sudhansu Sekhar Mishra1

1 Fish Health Management Division, ICAR-Central Institute of Freshwater Aquaculture (ICAR-CIFA), Kausalyaganga, Bhubaneswar, Odisha-751002, India

2Regional Research Station, ICAR - Central Institute of Freshwater Aquaculture, Indian Council of Agricultural Research (ICAR), Rahara, Kolkata - 700118, India

*Corresponding author: Pushpa Choudhary, Fish Health Management Division, ICAR-Central Institute of Freshwater Aquaculture (ICAR-CIFA), Kausalyaganga, Bhubaneswar, Odisha-751002, India.

Chinmayee Muduli, Fish Health Management Division, ICAR-Central Institute of Freshwater Aquaculture (ICAR-CIFA), Kausalyaganga, Bhubaneswar, Odisha-751002, India

Received: 11 April 2025; Accepted: 17 April 2025; Published: 30 April 2025

Article Information
Citation: Shweta Priyadarshini Dash, Sasmita Mohanty, B Prince, Pushpa Choudhary, Chinmayee Muduli, Arabinda Das, Priyabrat Swain, Sudhansu Sekhar Mishra. Optimizing the Effects of Dietary Tridax Procumbens leaf Extract on Growth Performance, Antioxidant Activity, Immune Response, and Disease Resistance Against Aeromonas Hydrophila in Labeo rohita. Archives of Microbiology and Immunology. 9 (2025): 141-157.

DOI: 10.26502/ami.936500217

Share
Abstract

Asian ayurvedic herb Tridax procumbens (TP) has long been used for therapeutic purposes. However, the effects of TP on Labeo rohita remain ambiguous. Consequently, the present study investigated the impact of T. procumbens leaf extract (TPLE) on the growth performance, immune response, and disease resistance in the Indian major carp, Labeo rohita, across four treatment groups, followed by an anti-infection treatment against Aeromonas hydrophila. Fish were fed a basic diet fortified with 0%, 0.2%, 0.4%, and 0.8% of TPLE for 60 days. The results of this study demonstrate that the TLE0.4 and TLE0.8 diets considerably outperformed the control group in terms of growth performance, total protease, α-amylase activity, respiratory burst activity, lysozyme activity, myeloperoxidase activity, mucus, and serum bactericidal activity (P<0.05). Furthermore, the TLE0.4 and TLE0.8 extract-fed groups showed a significant decrease (P<0.05) in glucose content and a notable increase (P<0.05) in total protein, albumin, alkaline phosphatase, and superoxide dismutase compared to the control group. Moreover, the expression of pro-inflammatory cytokines (IL-1β, TNFα), antioxidant molecules (SOD, GPx, catalase), and pattern recognition molecules (TLR 22) was significantly upregulated by TLE0.8 supplemented diet. In contrast, the expression of cytokines such as IL-8, IL-10, and TGF-β was downregulated. The relative percentage of survival (RPS) analysis revealed that the TLE0.4 and TLE0.8 diet-fed groups had 83.30% and 77.73% of survival, respectively. Thus, our study demonstrated that incorporating TLE0.8 and TLE0.4 into the diets of L. rohita would enhance growth performance, antioxidant activity, immune response, and disease resistance against A. hydrophila infection.

Keywords

TPLE, Labeo rohita, growth performance, immune response, antioxidant activity, disease resistance

TPLE articles, Labeo rohita articles, growth performance articles, immune response articles, antioxidant activity articles, disease resistance articles.

Article Details

Abbreviations: TPLE, Tridax procumbens leaf extract; TLE, Tridax leaf extract; RBA, respiratory burst activity; MPO, myeloperoxidase activity; ALP, alkaline phosphatase; SOD. superoxide dismutase; GPx, Glutathione peroxidase; CAT, Catalase; RPS, relative percentage of survival; FRP, fiberglass reinforced plastics; WGP, Weight gain percentage; FCR, Feed Conversion Ratio, FER, Feed Efficiency Rate; SGR, Specific Growth Rate; FW, final weight; IW, initial weight; DW, dry weight; WW, wet weight; ln, natural log; N, number of culture days; FBW, final body weight; WG, weight gain; PER, protein efficiency ratio; TP, total protein; Ig, globulin; TP, T. procumbens

Introduction

Globally, aquaculture is acknowledged for its advantages in improving socioeconomic development, reducing poverty, and increasing food and nutritional security. In 2022, the combined output of fisheries and aquaculture hit a record-breaking 223.2 million tonnes, while the total amount produced worldwide hit a new high of 130.9 million tonnes, valued at USD 313 billion. The industry has been expanding at an average annual growth rate of 5.25% since 2000, ensuring food and livelihood security. Asia alone accounted for 91.4% of the world's aquaculture production (1,2). Indian major carp, Labeo rohita, is among the most coveted species for aquaculture and is one of the most extensively farmed fish in the Asia-Pacific region. In the modern era, increased aquaculture production from intensive farming has resulted in a highly stressed and crowded environment with degraded water quality, resulting in the frequent occurrence of diseases (3). Pathogens and the diseases they induce pose a significant challenge for the aquaculture industry to attain sustainability and reach its full potential (4). Opportunistic pathogens like Aeromonas hydrophila are major infectious disease-causing bacterial pathogens in L. rohita farming, incurring high incidences of mortalities and substantial financial loss, severely impeding aquaculture production (3–6). According to previous reports, Aeromonas hydrophila infections in L. rohita may result in various clinical manifestations like fin rot, tail rot, skin erosion, hemorrhages, abdominal swelling, and infection of internal organs such as the liver and spleen, as well as oxidative stress (5,7,8).

The prevention and treatment of diseases in aquafarming can be achieved through various means. These include immunostimulants, vaccinations, RNA and phage therapies, antimicrobial peptides (AMPs), phytotherapeutic substances, pre-, pro-, and postbiotics, chemicals, and recommended antibiotics (9). However, the inappropriate application of chemicals and antibiotics to treat bacterial infections in fish has led to serious issues like drug residues, contamination of the environment, and bacterial resistance (10). Further, the aquaculture supply chain may play a crucial role in the spread of bacteria resistant to antibiotics due to horizontal gene transfer from cultivated species to humans (11). To mitigate infectious diseases in fish, vaccines are employed; however, commercial vaccinations are expensive for fish producers. Therefore, it is necessary to adopt natural alternatives like phytochemical and phytobiotic medications in intensive and large-scale fish farming (12). As an alternative to traditional fish disease treatment, phytotherapy is natural, eco-friendly, biodegradable, and cost-effective against a wide range of bacterial diseases in aquaculture. Research has been centered on comprehending dietary supplements of phytotherapeutic substances that strengthen the aquatic species' innate immune defenses and elevate resistance to infections (13).

Over the past two decades, immunostimulatory and oxidative ingredients fortification or supplementation in the feed composition of aquatic animals has increased (14,15). This has sparked interest in biologists as this formulation has the potential to improve fish's immune systems. Phytochemicals containing active molecules such as flavonoids, steroids, alkaloids, saponins, terpenoids, tannins, glycosides, phenolic compounds, polysaccharides, pigments, organic acids, and essential volatile oils have been reported to exhibit growth-promoting, immunomodulatory activity, antibacterial, antiparasitic, antistress, appetite-stimulating in fish and shellfish that can enhance production performance and influence productivity in the aquaculture sector (13,14,16–19). Herbal or plant extracts mainly enhance the bactericidal effects, stimulate the phagocytic activity of cells, and support natural killer cell activity as well as improve the fish antibody responses (20). Several studies have monitored the immunological parameters after intraperitoneal injection or oral administration of plant extracts on distinct fish species and they found that treated fish showed increased haematological parameters, serum total protein (globulin and albumin), total immunoglobulin, myeloperoxidase activity, respiratory burst activity, bactericidal activity, complement activity, lysozyme activity, and phagocytic activity (21–24). Antioxidant and immune gene expression also get upregulated following herbal plant extract feeding in fish species, thereby protecting them from infectious pathogens (25–27). Enhancement of growth, antioxidative activity, haematological, nonspecific immune response, immune-related gene expression, disease resistance, and stress elimination has been reported in several fish species upon dietary supplementation of plant extract (25,28–30).

Tridax procumbens is a beneficial plant well-known for its bioactive components such as alkaloids, hydroxycinnamates, tannins, and phytosterols, which exhibit antioxidant, anti-inflammatory, anaesthetic, and anti-diabetic properties (31). A study revealed that T. procumbens incorporated diets enhanced serum protein profile, glucose levels, and bactericidal and lysozyme activity in Nile tilapia (32). The T. procumbens (63.3%) phytobiotics added to the Nile tilapia diet improved the feed efficiency, growth performance, immune response, and disease resistance against A. hydrophila. However, to the best of our knowledge, there is scant scientific evidence in favor of using T. procumbens in L. rohita as a dietary supplement. Therefore, our current investigation aimed to unravel the possible effects of regularly incorporating T. procumbens into L. rohita diets during their early life stages at doses T1: 2.0 g (0.20%); T2: 4 g (0.4%) and T3: 8 g (0.8%) extract kg -1of basal feed, respectively, and its effect on growth, antioxidative activity, hematological, immune response, immune-related gene expression, and disease resistance.

Materials and Methods

Methanolic extract of Tridax procumbens leaf extract

Extraction of TPLE was achieved following (33) with mere modifications. The plant taxonomy department at OUAT, Odisha, carefully identified fresh Tridax procumbens leaves collected at the ICAR-CIFA campus in Bhubaneswar, Odisha, ensuring the plant material's accuracy. The leaves were thoroughly washed with distilled water, followed by shade drying and occasional sun drying. After that, TPL samples were dried to constant weight at 70 °C. A mechanical grinder was used to grind the dried leaf materials into a fine powder, which was then kept for later usage at room temperature. After collecting the material, TPLE was crushed into a powder using an electric micro-pulverizer and then sieved through a 40-mesh sieve. After dissolving 50 g of dried sample in 500 mL of methanol, the samples were placed in a water bath at 37 °C for 48 hours. Following the completion of extraction in a rotary evaporator, the fine powder was labeled and kept for later use at 4 °C.

Fourier Transform Infrared (FTIR) characterization

The leaf extract of Tridax procumbens was characterized by FTIR (PerkinElmer, Spectrum II) using the central facility of OUAT, Bhubaneswar, India.

Gas chromatography-mass spectrometry (GC-MS) analysis

At the ICAR-National Rice Research Institute (ICAR-NRRI), Cuttack, India, a GC-MS apparatus (Shimadzu TQ8040, Shimadzu Corporation, Kyoto, Japan) with an Rxi-5-Sil MS (30 m × 0.25 mm, 0.25 μm) capillary column was used to evaluate the phytochemical composition of TP leaf extract. The TP leaf extract was diluted with methanol and then filtered by either direct injection into GC-MS or poly-tetrafluoroethylene. Utilizing helium as the carrier gas and keeping the GC injector temperature at 250ºC, the analysis was conducted in accordance with the phytochemical methodology (34). Each compound was identified by comparing the MS spectra from the reference library. Additionally, AMDIS software was employed for analyzing the data to determine the compounds, and KOV´ATS retention indices were computed to identify the phytochemicals based on peak area percentage and retention time, as represented in Table 4.

DPPH assay for in-vitro antioxidant activity

Using the method outlined by (35), the antioxidant capacity of tridax plant leaf extract was assessed by measuring the DPPH (1,1-diphenyl-2-picrylhydrazyl) free radical scavenging activity. In short, methanol was diluted with various amounts of Butyl Hydroxy Toluene (BHT) (10.0, 20.0, 30.0, 40.0, and 50.0 μg/ml). Further, 3.9 ml of a 0.2 mM DPPH solution and control were mixed with 0.1 ml of diluted leaf extract and BHT solutions.

Fish rearing and experimental conditions

The L. rohita fingerlings (n=180, average weight 12.24 g ± 0.5 g) were obtained from the carp culture unit, ICAR-CIFA, Bhubaneswar, India, without any prior history of infection or disease. With gentle aeration, the fish were acclimatized for three weeks in 500 L fiberglass reinforced plastics (FRP) tanks. Commercial feed was fed to the fish during this period, comprising 28 % protein at 2% body weight twice daily. After acclimatization, the healthy, energetic fish were randomly distributed into 12 independent FRP tanks with 400 L of fresh, aerated water that contained 15 fish per tank. Dietary interventions were created as follows: control (C): basic diet devoid of extract; T1: 2 g (0.20%) extract kg -1 of basal feed; T2: 4 g (0.4%) extract kg -1 of basal feed and T3: 8 g (0.8%) extract kg -1of basal feed. The same amount of feed was added to each tank during the 60-day trial periods, and the ratio was divided into two equal daily portions (10:00 am and 4:00 pm). To maintain optimal water quality, the experiment was conducted in triplicate, with frequent exchanges of around thirty percent of the tank's water. Critical water quality indicators, including temperature, total alkalinity, dissolved oxygen, and total ammonia nitrogen, were measured and recorded at weekly intervals.

 

Herbal plant leaf collection and extract preparation

Fresh Tridax procumbens leaves were collected from ICAR-CIFA, Bhubaneswar campus, and meticulously identified by the plant taxonomy department of OUAT, Odisha, ensuring the accuracy of the plant material. To process the extraction, the leaves were carefully cleaned and dried in a 40 °C oven for 24 h. The leaves were mechanically grounded into tiny pieces and allowed to dry before being powdered. Subsequently, they were subjected to adding 50% methanol at a ratio of 1:10 (weight: volume). After 48 hours at room temperature and churning with a magnetic stirrer set at 120 rpm, the liquid was thoroughly mixed. Using an autoclaved funnel, the extract mixture was filtered using Whatman paper (No. 1, 42 μm pore size) to remove any minuscule particles. An oscillating evaporator with a 60 °C setting was used to extract the resulting alcohol from the filtered mixture (36). The powdered extract is stored at -4°C within an airtight glass container until further usage.

Preparation of experimental diet and feeding

Four experimental diets that were made with graded levels of leaf extract are described earlier. Inclusion levels were determined based on studies done on other fish (37). Feed ingredients that were readily available locally were used for the preparation of the basal feed Table 1. Ingredients were meticulously ground, weighed, mixed, and prepared as a dough, which was then used to prepare feed pellets. Before being fed to the fish, all manufactured pellets, including the various experimental and control feeds, were crushed to a 2-mm diameter, dried for the entire night, and then kept in storage at 4 °C. The experimental and control groups were fed @ 3% of the fish's body weight for 60 days. Using the conventional protocol, the composition of the experimental diet was determined (38).

Table 1: The feed preparation (ingredients in g, used for 1 kg of feed) of the basal and experimental diet in rohu fingerlings a Composition of vitamin-mineral premix (PREEMIX PLUS) (quantity/2.5 kg).

Feed Ingredients (g)

Control (g kg-1 of feed)

0.2% TLE (g kg-1 of feed)

0.4% TLE (g kg-1 of feed)

0.8% TLE (g kg-1 of feed)

Fish meal

50

50

50

50

Soy meal

280

277.5

275

270

Ground nut oil cake (GNOC)

260

260

260

260

Rice bran

200

200

200

200

Corn flour

150

150

150

150

Oil mix (ml)

40

40

40

40

Vitamin and mineral mixturea

20

20

20

20

Extract (TPLE)

0

2

4

8

Vitamin A, 5500000 IU; Vitamin D3, 1100000 IU; Vitamin B2, 2000 mg; Vitamin E, 750 mg; Vitamin K, 1000 mg; Vitamin B6, 1000 mg; Vitamin B12, 6 mcg; Calcium Pantothenate, 2500 mg; Nicotinamide, 10 g; Choline Chloride, 150 g; Mn, 27,000 mg; I, 1000 mg; Fe, 7500 mg; Zn, 5000 mg; Cu, 2000 mg; Co, 450 mg; L- lysine, 10 g; DL- Methionine, 10 g; Selenium, 50 ppm; Satwari, 2500 mg.

Sampling of fish

Five fish were taken from each tank, randomly. After anesthetizing fish with 50 μl/L of clove oil (Himedia, India), samples of blood were extracted from the caudal vein by a 2 mL hypodermal sterile syringe. Collected blood was split into two microcentrifuge tubes, one of which had a thin film of the anticoagulant EDTA on it and the other without, so that the serum could be collected. Vials coated with EDTA were gently shaken to avoid hemolysis and blood coagulation. Serum was obtained and stored at a low temperature until required, following the procedure explained by (39). To get digestive tissues, a random sample of three fish was taken from each tank. The intestines of each fish were removed, and the adipose tissue was carefully cleaned. In addition, tissue samples were cleaned and homogenized using an electric blender at 8000 rpm for 30 s. Simultaneously, a cold solution of 50 mM tris-HCl with a pH of 8.1 was blended. To extract tissue fragments and lipids, the homogenate was centrifuged at 10,000 ×g (4 °C) for 20 min. The 1.5 mL Eppendorf vials containing the tissue extract supernatant were kept at −20 °C until the enzymatic analysis. In order to perform a whole-body proximate composition investigation Table 2, three extra fish were randomly picked from each tank, sliced, pooled, & frozen at -20 °C.

Table 2. Proximate composition of diets. Data expressed as mean ± SE (n = 3)

Moisture (%)

Protein (%)

EE (%)

Ash (%)

Crude fibre (%)

NFE (%)

Energy (kcal/100 g)

8.42 ± 0.05

29.00 ± 0.03

7.89 ± .058

8.21 ± 1.13

4.98 ± 0.31

38.29 ± 1.00

421.72 ± 0.69

Growth indices

After the trial period of 60 days was over, four fish each from the three treatment groups and the control were taken out, and their growth indices were estimated as follows:

  1.  “Weight gain (%) (WGP) = (Final weight - Initial weight) X 100/ Initial weight,
  2.  Feed Conversion Ratio; FCR = Feed given (DW)/body weight gain (WW),
  3.  Feed Efficiency Rate; FER=1/FCR,
  4.  Specific Growth Rate; SGR (%) = [ln (FW) − ln (IW)/N] × 100.

Where FW=final weight, IW=initial weight, DW=dry weight, WW=wet weight, ln=natural log, and N=number of culture days, respectively.

Estimation of non-specific immune parameters

The methods described by (40) were followed to estimate the serum lysozyme content. After an hour of blood collection, the respiratory burst activity (RBA) of the blood was determined in accordance with (41). The protocol described by (42) was followed to assess the serum myeloperoxidase (MPO) activity.

Estimation of biochemical parameters

Total serum albumin was assessed using the albumin kit (Merck, India) using the bromocresol green binding method as reported by (43)Total serum protein was estimated by following the manufacturer's instructions in the total protein kit (Merck, India). The serum albumin readings were subtracted from the total protein value to determine the serum globulin content. A commercial kit (Caymans Chemical, USA) was used to assess the antioxidant enzymes in the serum, specifically the SOD and catalase activities following the manufacturer’s instructions.

Blood and mucus sampling

The control and experimental animals were deprived for a full day on the 60th day of the experiment in order to collect samples of mucus and blood. 50 µg L-1 of clove oil was used to anesthetize five fish that were arbitrarily selected from each of the FRP tanks (5 fish from each of the replicas or 15 individuals from each treatment). Blood was drawn from every fish's caudal peduncle using a 2 mL disposable syringe. Blood was collected, and in order to get the serum, it was held for four hours at 4 °C for blood coagulation in a 1.5 mL microcentrifuge tube that had not been heparinized. Serum was extracted from the coagulated blood by centrifuging it at 2500 × g for 15 minutes at 4 °C. The serum samples from the treatment and control groups were stored at -80 °C prior to additional analysis (44). Furthermore, the technique described by (45) was followed to acquire skin mucus samples. Fish were placed in polyethylene bags with a 50 mM NaCl solution to collect mucus. Followed by gentle shaking of the fish inside the bags for a small duration to get mucus samples from the fish skin epidermal layer. The collected mucus samples were transferred to a sterilized 2 mL microcentrifuge tube, and centrifugation was done at 1300 rpm for 20 min in the refrigerated centrifuge, followed by the collection of supernatant and storage at – 80 °C in an ultra-freezer until further analysis (45).

Serum & mucus bactericidal activity test

A small modification to the (46) approach was followed to test the bactericidal activity of serum and mucus. After being incubated at 37 °C in a shaker incubator, the bacterial culture of A. hydrophila was obtained in a nutritional broth. The nutrient agar plate was then completely swabbed with 1.2 × 108 CFU mL-1 A. hydrophila. Following a 25-minute absorption period on 6 mm sterilized paper discs, 150 µl of serum and mucus samples were deposited on a solid agar plate (47). Plates were incubated at 37 °C for a single day. A digital caliper was used to assess the diameter of the growth inhibition zones after 24 h.

RNA extraction & cDNA synthesis

Following the manufacturer's directions, RNA was extracted from liver tissue samples from rohu using Thermo Fisher Scientific's TRIzol reagent. To get rid of any potential contamination from genomic DNA, isolated RNA was treated with DNase I (Takara, Japan). The quality and quantity of the extracted RNA were quantified using a NanoDrop ND1000 spectrophotometer (Thermo Scientific, USA). The oligo-dT primer was selected to synthesize the cDNA first-strand using the PrimeScript 1st strand cDNA Synthesis Kit (Takara, Japan).

Quantitative real-time PCR (RT-qPCR)

Using previously published primers, RT-qPCR was performed to examine the expression levels of genes related to pattern recognition molecule (TLR 22), pro-inflammatory cytokines (IL-1β, IL-8, TNF α), anti-inflammatory cytokines (IL-10), regulatory cytokines (TGF-β) and antioxidant molecules (SOD, GPx, catalase).  Sigma-Aldrich provided the synthetic primers that were used in this process. Table 3 is a list of the primers' specifications. The specificity of the primers was verified by semi-quantitative PCR. The qRT-PCR was performed using SYBR® Premix Ex TaqTM II (TliRNaseH Plus) (Takara Bio Inc., Japan) in the StepOnePlusTM Real-Time PCR system (Applied Biosystems, USA) in accordance with the manufacturer's instructions. In summary, a final 14 μl reaction mixture included 6.25 μl SYBR green master solution, 0.5 μl (10 μM) of each forward and reverse primer, 0.25 μL of ROX, and 2 μL of 100 ng cDNA. The qRT-PCR methodology included 40 cycles of amplification (denaturation for 10 s at 95°C, annealing for 10 s at a predefined temperature, and extension for 10 s at 72°C) after a preliminary denaturation at 95°C for 10 min. Then, with cooling at 37 °C for 30 s, melt curve analysis was carried out at 95 °C for 15 s, 60 °C for 60 s, and 97 °C for 1 s. A triple control without a template was carried out for each gene. For each sample, the relative gene expression studies were performed in triplicate using β-actin as the reference gene. The 2-ΔΔCT approach was applied to ascertain the fold change in the experimental group (48).

Table 3: Information about primers used in the real-time gene expression analysis

Target Gene

Nucleotide base sequence (5′–3′)

Reference

β-actin

F- TTGGCAATGAGAGGTTCAGGT

-49

R- TTGGCATACAGGTCCTTACGG

TLR 22

F-TCACCCCATTTCGAGGCTAACAT

-50

R-GAAGGCGTCGTACTGGAATGTC

TNF α

F-CCA GGCTTTCACTTCAGG

-51

R- GCCATAGGAATCGGAGTAG

IL-1β

F- GTGACACTGACTGGAGGAA

-52

R-AGTTTGGGCAAGGAAGA

IL-8

F- AAAGGGTTCTTACTGG

-53

R- TTTAGACATCTCGGACT

IL-10

F- CTCATTTGTGGAGGGCTTTC

-54

R- ATGCCAGATACTGCTCGATG

TGF-β

F-ACGCTTTATTCCCAACCAAAC

-55

R-GAAATCCTTGCTCTGCCTCA

SOD

F-GTGGTTGTAATGTGTTCTGA

-56

R- TCTGGAATGTTGTGAATTGG

catalase

F-ACCTCTACAACGCCATCT

-56

R- ATTCCACTTCCAGTTCTCAG

GPx

F- TCAATGACATCAAGTGGAAC

R- ACAAGCTGACGGAAGTATT

-56

Challenge Test

As previously described by (57), A. hydrophila obtained from the fish health and management division (FHMD), ICAR- CIFA, Bhubaneswar, India, was employed for experimental infection. Stock cultures were kept at −70°C in a Tryptic Soy Broth (TSB) solution with 15% glycerol. To prepare bacteria for the challenge test, A. hydrophila from stock was grown in TSB for 24 hours at 37 °C. The cells were centrifuged at 3,000 g for 15 minutes, and then they were cleaned three times using sterile phosphate-buffered saline (PBS, pH 7.2). The optical density of the bacterial suspension was determined to be around 108 CFU/mL at 540 nm. According to (58), six fish were randomly selected from each tank and eighteen from each treatment group, after 60 days of feeding with the experimental diets, and were intraperitoneally injected with A. hydrophila (108 CFU). The fish that had perished were taken out of the tanks after the challenge. The following formula (59) was used to calculate the relative percentage of survival (RPS) (%) = (no. of fish surviving after challenge/no. of fish injected with A. hydrophila) ×100.

Data analysis

The software SPSS ver. 14.0 (IBM, USA) was used to perform an ANOVA on the data in order to identify any significant differences between the means. Additionally, the data were examined for homogeneity of variance (Levene's test) and normality (Shapiro-Wilk test) (60). The average ± standard error (SE) is displayed for the data. P < 0.05 was found to be statistically significant.

Results

Infrared Characterization

The FTIR analysis exhibits absorbance peaks corresponding to various functional groups in the 4000 to 400 cm–1 range, as shown in Fig 1. The major bands in leaf extract were detected at 3293, 2931, 2206, 2171, 2103, 1995, 1683, 1628, 1607, 1515, 1445, 1366, 1270, 1183, 1165, 1102, 1071, 1042, 923, 898, 851, 813, 769, 504, 487, 452, 445, 426, 419 and 410 cm-1. The strong and broad O-H stretch at 3293 cm-1 results from intramolecular hydrogen bonding in alcohols and phenols, while the band at 2931 cm-1 corresponds to C-H stretching vibrations. Additionally, alkynes (C≡C stretch) and nitriles (C≡N stretch) are characteristic of peaks at 2206 cm–1, 2171 cm–1, and 2103 cm–1. Similarly, the peak at 1683 cm–1 reveals distinctive bands of carboxylic acids, whereas the peaks at 1628 cm–1,1607 cm-1, and 1515 cm-1 represent amines observed in N-H bending. Furthermore, the C-H bending is represented by the peak in the fingerprint region at 1445 cm-1, while C-O stretching and glycosidic linkage (C-O-C) are denoted by the peaks at 1183 cm-1, 1165 cm-1, and 1102 cm-1–1042 cm-1, respectively. Multiple functional groups, commonly associated with methyl, phenol, carboxylic acid, alkynes, nitriles, polysaccharides, and amide groups, are detected in the leaf extract according to the FTIR data. These groups are components of different biomolecules. Thus, the T. procumbens leaf extract identified functional groups as characteristic of compounds like tannins, amides, flavonoids, amino acids, and polysaccharides.

fortune-biomass-feedstock

Figure 1: Fourier Transform Infrared (FTIR) spectrum of Tridax procumbens leaf extract

GC-MS analysis of methanolic TP leaf extract

Table 4 lists the 30 main components that were identified by GC-MS profiling of methanolic TP leaf extract. Table 4 lists the compound name, peak area, and peak area (%), retention time (min), and retention index (calculated and literature). The unique chromatogram of the leaf extract is displayed in Fig. 2. Methyl esters of hexadecanoic acid, 9-octadecenoic acid, γ-Sitosterol, Decane, and Phytol, among others, were significant constituents in the plant extract.

Table 4: Components identified in GC-MS analysis of Tridax extract

Sl.No.

Retention time (Min)

Compound

Area

% Area

Calculated RI

Lit. RI

1

3.435

N-Methoxy-N-methylacetamide

537354

3.47

-

696

2

3.925

Propanoic acid, 2-oxo-, ethyl ester

161668

1.04

820

822

3

5.425

2-Furanmethanol

46372

0.3

880

885

4

8.805

Decane

244932

1.58

997

1000

5

12.86

4H-Pyran-4-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-

242112

1.56

1136

1154

6

15.375

Benzofuran, 2,3-dihydro-

102564

0.66

1223

1223

7

19.325

n-Decanoic acid

20267

0.13

1368

1372

8

28.38

2-Propenoic acid, 3-(4-hydroxyphenyl)-, methyl ester

187979

1.21

1752

1698

9

28.55

Tetradecanoic acid

19933

0.13

1760

1769

10

29.29

2-Cyclohexen-1-one, 4-hydroxy-3,5,5-trimethyl-4-(3-oxo-1-butenyl)-

115514

0.75

1794

1751

11

31.9

Hexadecanoic acid, methyl ester

254233

1.64

1924

1912

12

32.61

n-Hexadecanoic acid

252130

1.63

1961

1968

13

34.835

9,12-Octadecadienoic acid (Z,Z)-, methyl ester

134718

0.87

2093

2093

14

34.935

9,12,15-Octadecatrienoic acid, methyl ester, (Z,Z,Z)-

360604

2.33

2099

2101

15

35.09

Phytol

770371

4.97

2111

2105

16

35.27

Methyl stearate

36824

0.24

2125

2113

17

35.375

9,12-Octadecadienoic acid (Z,Z)-

140739

0.91

2133

2134

18

35.475

9,12,15-Octadecatrienoic acid, (Z,Z,Z)-

511589

3.3

2141

2143

19

35.73

Octadecanoic acid

56265

0.36

2161

2161

20

36.71

Benzyl beta-d-glucoside

367895

2.37

2243

2461

21

39.32

Hexadecanoic acid, 2-hydroxy-1-(hydroxymethyl)ethyl ester

470030

3.03

2509

2498

22

40.675

1-Hexacosanol

48693

0.31

2676

2848

23

41.005

Octadecanoic acid, 2,3-dihydroxypropyl ester

339338

2.19

2718

2681

24

41.22

γ-Sitosterol

1942555

12.54

2745

2731

25

41.38

Stigmastanol

74030

0.48

2765

2720

26

41.545

Stigmasta-5,24(28)-dien-3-ol, (3-beta,24Z)

229553

1.48

2786

2780

27

41.9

(9Z,12Z,15Z)-3,7-Dimethyloct-6-en-1-yl octadeca-9,12,15-trienoate

371684

2.4

2828

2896

28

42.91

9,19-Cyclolanost-24-en-3-ol, (3-beta)-

348782

2.25

2934

2816

29

44.27

(+)-γ-Tocopherol, O-methyl-

587946

3.8

3053

3004

30

44.575

γ-Sitostenone

2315852

14.95

3077

3483

fortune-biomass-feedstock

Figure 2: GC-MS Chromatogram of Tridax procumbens methanolic leaf extract

DPPH free radical scavenging assay

Using butylated hydroxytoluene (BHT) as a reference, the Tridax leaf extract's in vitro antioxidant potential was assessed. Based on the calibration regression equation, it was determined that 100 µg/ml of leaf extract equates to 57.283 μg/ml of BHT activities as shown in Fig 3.

fortune-biomass-feedstock

Figure 3: Calibration curve for determination of free radical scavenging ability of Tridax leaf extract by DPPH assay

Growth performance & feed utilization

The growth performance & feed utilization were analyzed upon feeding a selected concentration of Tridax leaf extract (TLE) to rohu. Table 5 displays the rate of growth & feed consumption of L. rohita fingerlings. This study found a statistically significant difference in the FBW: final body weight, WG: weight gain, SGR: specific rate of growth, FCR: feed conversion ratio, & PER: protein efficiency ratio between the TLE0.2, TLE0.4, and TLE0.8 dietary & control groups (P<0.05). The ultimate body wt., WG, SGR, and PER of the fish-fed TLE0.8 and TLE0.4 groups were higher (P<0.05) than those of the control group. The group under control demonstrated reduced weight gain, SGR, and PER among the dietary categories. Fish fed TLE0.8 showed a reduced FCR, while fish in the control group showed a greater FCR.

Table 5: Effects of different doses of Tridax procumbens leaf extract on growth indices, feed utilization, and survival of rohu juveniles

Growth indices

Control 

TLE0.2

TLE0.4

TLE0.8

P value

IBW (g fish-1)

18.17±0.60

18.03±1.03

17.83±1.18

19.13±0.31

0.719

FBW (g fish-1)

31.07±1.21a

34.13±0.49b

36.87±0.69b

41.07±1.04c

0

WG (g fish−1)

12.90±1.20a

16.10±1.04ab

19.03±0.82bc

21.93±0.82c

0.001

WG (%)

71.28±7.58a

90.53±11.32ab

108.21±11.39b

114.60±3.46b

0.037

SGR (%g day−1)

0.89±0.07a

1.07±0.09ab

1.22±0.09b

1.27±0.03b

0.033

FCR

2.59±0.20b

2.05±0.15ab

1.7±0.12a

1.57±0.03a

0.035

PER

1.45±0.09a

1.8±0.23ab

2.15±0.33b

2.47±0.34b

0.038

Survival (%)

100

100

100

100

-

Values presented as Mean ±SE (n=3); Mean values in the same row with different superscripts differ significantly (P<0.05). IBW: initial body weight, FBW: final body weight, WG: weight gain, SGR: specific rate of growth, FCR: feed conversion ratio, & PER: protein efficiency ratio

Digestive enzyme

The changes in digestive enzyme levels were analysed upon feeding selected concentrations of different TLE to rohu. Fig 4 displays the particular activities of α-amylase and total protease. Total protease & α-amylase activity in the gut of L. rohita fed with various TLE-supplemented meals showed a significant difference (P<0.05). Compared to the group under control, fish-fed with TLE showed increased activity of α-amylase & total protease, with fish-fed TLE 0.8 exhibiting the highest activity.  Notably, the control group had significantly reduced levels of total protease and α-amylase activity.

fortune-biomass-feedstock

Figure 4: The specific activity of amylase and protease in rohu fed with a graded level of Tridax leaf extract (TLE). Bars presented as Mean ±SE. Different letters above the bar denote significant differences between dietary groups (P<0.05)

Effects of T. procumbens leaf extract on non-specific immune parameters

The modulation of non-specific immune parameters in serum and mucus was analysed upon feeding selected different concentrations of TLE to rohu. Table 6 shows the serum levels of MPO, lysozyme, & RBA in the treatment and control groups. The values of the fish-fed TLE0.4 and TLE0.8 diets were considerably higher (P<0.05) compared to those of the control. Mucus Lysozyme activity, & MPO at OD 450nm as represented in Table 6. It showed significantly higher differences in TLE0.8 and TLE0.4 diets when compared to the control group.

Table 6: Effects of different doses of Tridax procumbens leaf extract on serum immune parameters, antioxidants, and stress parameters of rohu juveniles. Data presented as Mean ±SE Different letters above the value denote significant differences between dietary groups (P<0.05).

Parameters

C

TLE 0.20

TLE 0.40

TLE 0.80

P value

RBA (OD 540)

0.26 ± 0.015a

0.27± 0.005a

0.31 ± 0.006b

0.32 ± 0.011c

0.004

MPO (OD 450)

0.24± 0.001a

0.26± 0.007b

0.30 ± 0.005c

0.32 ±0.003cd

0

Lysozyme

61.4 ± 3.2ab

62 ± 0.88b

65.3 ± 1.8b

66.8 ± 1.3b

0.033

Ig (mg/dl)

3.63 ± 0.07a

3.65 ± 0.072a

3.82 ± 0.21b

3.7 ± 0.2a

0.027

TP (mg/dl)

2.72 ± 0.02a

2.75 ± 0.01ab

2.8 ± 0.02bc

2.85 ± 0.03c

0.015

Albumin (mg/dl)

1.28 ± 0.02a

1.36 ± 0.01ab

1.45 ± 0.02b

1.37 ± 0.03ab

0.036

SOD (U/ml)

77.33 ± 1.2a

81.33 ± 3.2ab

85.66 ± 3.4ab

88.9 ± 4.4b

0.072

CAT (U/ml)

26.66 ± 3.2a

31.33 ± 1.4ab

38.33 ± 2.2b

37.5 ± 2.2ab

0.031

Glucose(mg/dl)

115.6 ± 2.9b

104.0 ± 8.5b

101.3 ± 3.2ab

85.7 ± 4.7a

0.025

Effects of T. procumbens leaf extract on biochemical parameters

The changes in immune parameters, biochemical parameters, and antioxidant enzymes in serum and mucus were analysed upon feeding a selected concentration of TLE to rohu. Serum albumin, total protein (TP), and globulin (Ig) in the treatment and control groups are shown in Table 7. All three treatment groups, TLE0.2, TLE0.4, and TLE0.8 (P<0.05), showed significant differences from the control group. Serum antioxidant enzyme activity is shown in Table 7 for catalase (CAT) and superoxide dismutase (SOD). The highest activities were observed in TLE0.4 & TLE0.8 (P<0.05) compared to the control group. TLE0.8 had significantly lower serum glucose activity (P<0.05) than the control group (Table 7). Mucus TP showed a significant difference, as shown in Table 7. In all three treatment groups, TPL0.4, TLE0.8, and TLE0.2 (P<0.05) from the control group. Mucus Alkaline phosphatase (ALP) and protease activity showed higher values in fish fed TLE0.8, followed by TLE0.4 and TLE0.2, in comparison to the group under control, as represented in Table 7.

Table 7: Effects of different doses of Tridax procumbens leaf extract on mucus immune parameters of rohu juveniles. Data presented as Mean ±SE Different letters above the value denote significant differences between dietary groups (P<0.05).

Parameters

C

TLE 0.20

TLE 0.40

TLE 0.80

P value

Lysozyme

44.70±1.46a

48.63±2.0ab

52.63±1.51bc

54.78±1.32c

0.009

MPO (OD 450)

0.27±0.008a

0.34±0.012b

0.38±0.003c

0.40±0.008c

0

TP (mg/dl)

2.38±0.035a

2.55±0.024b

2.71±0.04c

2.82±0.018d

0

ALP (IU/ml)

93.0±3.08a

98.11±3.17ab

102.10±2.42b

103.47±3.52b

0.013

Protease %

2.18±0.17a

2.32±0.13a

2.54±0.049ab

2.79±0.079c

0.024

Mucus & Serum Bactericidal Activity

The bactericidal activity of serum and mucus was studied upon feeding selected different concentrations of TLE in rohu. It was observed that the fish fed with TLE0.2, TLE0.4, and TLE0.8 diets had the highest zone of inhibition in their serum and mucus samples compared to the group under control, with the control showing the lowest values (P<0.05). A larger zone of inhibition indicates that fish fed with TLE diets are more potent than the control fish group. TLE0.4, followed by TLE0.8 and 0.2, have higher mucus bactericidal activity than the control group (P<0.05) as presented in Fig 5. Additionally, Fish fed with TLE0.4, TLE0.8, and TLE0.2 diets at 1.65, 1.52, and 1.27, respectively, had the highest serum level of bactericidal activity. Similarly, the highest mucus bactericidal activity was seen in fish fed with TLE0.4, TLE0.8, and TLE0.2 diets with growth inhibition zone diameters of 2.52, 2.40, and 1.85nm, respectively.

fortune-biomass-feedstock

Figure 5: The mucus and serum bactericidal activity in rohu upon feeding of Tridax leaf extract (TLE) diets for 60 days. The bar is displayed as Mean ± SE for the three treatment and control groups. A statistically significant difference (P<0.05) is shown by bars with different characters.

Effects of T. procumbens leaf extract on expression profiles of innate immune and antioxidant genes

The expression of pattern recognition molecule (TLR 22), pro-inflammatory cytokines (IL-1β, IL-8, and TNF α), anti-inflammatory cytokines (IL-10), regulatory cytokines (TGF-β), and antioxidant molecules (SOD, GPx, and catalase) were studied upon feeding different concentration of TLE. The TLE0.8 significantly (P < 0.05) raised the expression of TLR 22, IL-1β, TNF α, SOD, GPx, and catalase as compared to the control. In contrast, gene expression of IL-8, IL-10, and TGF-β was down-regulated. As illustrated in Fig 6A, B, and 7C, the addition of TLE0.2, TLE0.4, and TLE0.8 significantly elevated the expression of proinflammatory cytokines and antioxidant gene expression in comparison to the control. However, the expression of some pro- (IL-8), anti- (IL-10), and regulatory (TGF-β) cytokines was downregulated.

fortune-biomass-feedstock

Figure 6 A, B, C: The expression modulation of pattern recognition molecule (TLR 22), pro-inflammatory (IL-1β, IL-8, TNFα), anti-inflammatory (IL-10), regulatory cytokine (TGF-β) and antioxidant molecules (SOD, GPx, catalase) in rohu fed with graded level of Tridax leaf extract (TLE). The bar is displayed as Mean ± SE for the three treatment and control groups.

Challenge Study

Post-challenge survival (%) of L. rohita challenged with Aeromonas hydrophila after feeding on TLE diets was observed for 60 days. The RPS rates of the treatment groups are shown in Fig 7. Different fish fed with TLE supplementation had a substantial impact on RPS rates. The fish-fed TLE0.8, TLE0.4, and TLE0.2 diet groups had considerably higher RPS rates (P<0.05) compared to the control group. The fish-fed TLE0.8 and TLE0.4 diet groups showed significantly greater RPS rates compared to the TLE0.2 group (P<0.05). The TLE0.8 diet group had the greatest RPS (83.30%), followed by the TLE0.4 (77.73%), TLE0.2 (61.06%), and the control group (27.73%) (P<0.05).

fortune-biomass-feedstock

Figure 7: Post-challenge survival (%) of L. rohita challenged with Aeromonas hydrophila after feeding on Tridax leaf extract (TLE) diets. Significant differences between the dietary groups are denoted by different letters above the bar (P<0.05)

Discussion

Recent phytobiotic interventions in aquaculture have garnered interest as an environmentally friendly health management method and are being explored to promote fish growth, and immune responses, as well as to safeguard them against pathogenic ailments and stress (61–63). The present study describes the growth, immune, and antioxidant response-promoting effects of T. procumbens leaf extract (TLE) in L. rohita, revealing a more pronounced effect in the fish fed with TLE0.4 and TLE0.8 diet groups and significantly lower in the control group. It was observed that fish fed with 0.4% TPLE showed significantly lower body weight and Specific growth rate (SGR) % than the 0.8% TPLE group, but higher than the control group. This outcome could be a result of improved digestibility and feed intake, which would stimulate growth. Previous research has found that dietary supplementation with phytobiotics improves metabolism while also having antibacterial and anti-inflammatory properties (64). Our results are congruent with those of (65) African catfish were fed with varying levels of T. procumbens (TP) leaf meal (0.5, 1.0, 1.5, and 2.0 g/kg diet) for 56 days. They determined that performance deteriorated after reaching an elevated level at 1.0 g TP/kg diet. In a separate study (66) Nile tilapia-fed groups containing T. procumbens (TP) leaves at high doses (214.7, 322.1, 429.5, and 536.7 g/kg diet) for ten weeks revealed that the fish could sustain TP inclusion levels of up to 20% before slowing down their growth rate. The significant concentration of anti-growth and anti-nutritional components in the TP leaves diet may account for the reduced growth. However, the T. procumbens employed in our study was leaf extract rather than leaf powder, and its inclusion levels in meals were minimal, which has resulted in enhanced growth, demonstrating that low anti-growth and anti-nutritional ingredients.

A physicochemical analytical technique called Fourier transform infrared spectroscopy presents a precise representation of the metabolic makeup of leaves at a fixed period. It is considered one of the most effective methods for determining the functional groups that are present in compounds and for having a better understanding of their phytochemical properties (18,67). Thus, the purpose of the present investigation was to evaluate the effect on growth, immunity, and antioxidant activity when tridax extract is incorporated into feed. The extract's FTIR measurements revealed the presence of several functional groups, including methyl, phenol, carboxylic acid, alkynes, nitriles, polysaccharides, and amide groups. These compounds may be related to bioactive compounds like tannins and flavonoids, which play crucial roles in antioxidant activity (68,69), growth (70,71), and immunity (24,72). In our present investigation, the dietary inclusion of leaf extract may have contributed to the Labeo rohita's increased antioxidant activity and immunomodulation. According to the DPPH Assay, the leaf extract's antioxidant capacity was 57.283 μg/ml of equivalent BHT activities, which varies greatly among plants based on their source and growth conditions (73,74).

The present study evaluated the non-specific immunological parameters of L. rohita. The RBA, MPO, and lysozyme are crucial innate immunological metrics used to evaluate the innate immunity of fish (75,76). According to several studies, fish with diets including plant extracts or powder had higher lysozyme and RBA indices than control  (21–25,27–30,70,77) and all the variables have aided in defending against the invasion of pathogens. Similarly, our findings observed a significantly higher RBA, MPO, and lysozyme activity in the fish fed with the TLE0.4 and TLE0.8 diet when compared with the control. The activation of RBA and MPO results in the synthesis of oxidants, which lead to the oxidation of biomolecules, subsequently promoting inflammation and oxidative stress. Serum lysozyme is an essential antibacterial effector molecule that stimulates phagocytes and the complement system. Elevation of lysozyme level signifies the existence of many humoral components that can protect the host against the introduction of pathogens (22). According to GC-MS profiling, the presence of methyl esters of hexadecanoic acid and 9-octadecenoic acid appears to be linked to the enhanced lysozyme activity in our investigation. This suggests that the TLE0.4 and TLE0.8 diets have the capacity to boost the immune response and provide protection from several diseases in rohu. Furthermore, dietary supplementation with TPLE has a significant impact on the biochemical properties. The present study evaluated biochemical indices involving total protein with other critical indices such as AST, ALP, ALT, SOD, CAT, and glucose. According to (78), blood glucose levels are regarded as indicators of stress reactions since they are produced as secondary responses during stress to comply with enhanced energy requirements. Based on the current investigation, the fish fed with phytobiotics had lower glucose levels than the control group. This suggested that adding TPLE to L. rohita's diet provided additional stress reduction benefits. The TLE0.4 or 0.8-fed group showed significantly higher levels (P > 0.05) of total protein, albumin, ALP, and SOD compared to the control group. However, previous data (79,80) reported that feeding yellow perch and Nile tilapia 10 g/kg licorice showed reduced AST, ALT, and ALP activity when compared to the control group. The effects may be attributed to several TPLE bioactive components and secondary metabolites possessing antioxidant characteristics (81).

TPLE supplementation also had a significant impact on skin mucus immunological parameters in addition to serum immune parameters. Mucus on fish skin serves as the initial line of defense against pathogen invasion and is protected from infections by a thin physical, chemical, and biological barrier called the skin mucus layer, which also contains immune system components such as lectins, complement, immunoglobulins, and lysozyme (82,83) whereas Ig functions as an immune effector molecule in fish blood and fish skin, lysozyme is critical for mediating protection against microbial invasion (84) The most widely distributed immunoglobulin, IgM is necessary for systemic immune responses (85). In this study, the TLE0.8 diet-fed group had significantly higher serum and mucosal IgM and lysozyme activity. Similar to our findings, in zebrafish (86) and C. carpio (87,88) upon dietary supplementation of 0.8% ginger, 20g kg−1 of myrtle (Myrtus communis), and 200 mL/kg of DPFE stimulated the mucosal immune response. Seabream's skin mucosal IgM levels were raised by dietary fenugreek seeds (89). However, fenugreek seeds did not significantly affect the total Ig level in common carp skin mucus (90). Moreover, fish health can be precisely and noninvasively monitored by measuring changes in mucus protein levels. In the present study, mucosal lysozyme activity was considerably higher in the TLE0.4 and TLE0.8 fed groups than in the controls, with TLE0.8 being the most active. Furthermore, mucosal protein levels were higher in TLE0.4 and TLE0.8 than in the control (P <0.05), with TLE0.8 having the highest level. Although the difference was only significant in TLE0.8, there was a higher level of protease activity in the TLE0.4-fed groups compared to the control group.

In order to reveal the potential mechanism of immune stimulation following TPLE feeding in rohu, the expression of toll-like receptors, pro-, anti-, and regulatory cytokines, and anti-oxidant molecules was evaluated. In this study, the expression of pro-inflammatory cytokines (IL-1β, TNFα), antioxidant molecules (SOD, GPx, catalase), and pattern recognition molecules (TLR 22) was all significantly upregulated by the TLE 0.2, 0.4, and 0.8 supplemented diet with TLE0.8 having the highest level. Contradictorily, the expression of some pro- (IL-8), anti- (IL-10), and regulatory- (TGF-β) cytokines was downregulated compared to the control group, with TLE0.2 having the lowest level. In order to reduce oxidative stress in fish, GPx, SOD, and catalase enzymes are essential. These enzymes contribute to the enhancement of reactive oxygen species imbalance and the preservation of normal redox equilibrium in biological systems (81). Previous studies have demonstrated the modulation of immune and antioxidant genes upon supplementation of herbal ingredients in fish diets (12,25,28–30,77). In agreement with the previous studies, our results demonstrated that fish fed with a TLE0.8 diet increased the expression of antioxidant molecules (SOD, GPx, and catalase) which suggests that incorporating the TLE0.8 in to fish diet can lessen oxidative damage. The presence of phenolic substances such as tannins, phenol-carboxylic acids, and flavonoids may be linked to the improved antioxidant status in the rohu, as evidenced by the study's enhanced SOD activity in TLE0.8 (P < 0.05) (33,91) and can also be related to the FTIR results of our research. It has been reported that TPLE is rich in flavonoids, sterols, polysaccharides, phenolic content, and tannins (92). Therefore, based on in-vitro DPPH activity, tridax methanolic leaf extract can be regarded as a good antioxidant that has enhanced the SOD antioxidant enzyme status in rohu through diet.

Fish-specific TLR22 plays a crucial role in mucosal and systemic defense against bacterial infections (93,94). Elevation of TLR22 in rohu upon TPLE feeding indicates the immunostimulatory activity of TPLE. Earlier studies reported that Astragalus treatment elevated the production of pro-inflammatory cytokines TNF-α and IL-1β in common carp and yellow catfish (28). Similar to our study, feeding guava leaves downregulated the expression of IL-10 and TGF-β (93). Feeding of olive leaf (Olea europea L.) extract downregulated the IL-8 expression (95).  Further, another study reported the immunomodulatory characteristics of the ethanol-insoluble fraction of Tridax procumbens, which also revealed that its incorporation can improve growth, enhance immunity, antioxidant status, and resistance in the Nile tilapia, Oreochromis niloticus (96). These findings suggest that TPLE could be used to boost immunity and promote disease resistance in Labeo rohita. Mortality due to bacterial infection is an integral barrier to aquaculture, resulting in larger economic losses. The post-challenge survival rate may determine host health and evaluate the potency of immunostimulants like phytobiotics (58). The present study corroborates the research outcomes of Nile tilapia, indicating that the addition of T. procumbens enhances the antioxidant, immunity, & resistance (65). Further, tilapia fed with the TPLE diet exhibited a 10% reduction in fish mortality when compared to the control group (65). In our current investigation, RPS rates were significantly greater in the TLE diet-fed groups in the order of TLE0.8, followed by TLE0.4, and TLE0.2. Thus, TPLE administration may have improved immunological responses in challenged fish, leading to higher survival rates.

Conclusions

The present study reinforces the prospect for the functional feed additive application of T. procumbens leaves extract (TPLE) that can help strengthen the immune system and effectively enhance L. rohita's capacity for growth, immunological responses, & disease resistance, with the RPS rate being highest in the TLE0.4- 0.8 diet group when challenged with Aeromonas hydrophila, indicating no detrimental effects on fish welfare.

Acknowledgments

The authors would like to acknowledge the Director, ICAR-Central Institute of Freshwater Aquaculture, Bhubaneswar, India, for providing all the facilities required to successfully carry out the study. We also thank the Director, ICAR-National Rice Research Institute, Cuttack, India, and Hon’ble Vice Chancellor, OUAT, Bhubaneswar, India, for support in completing this study.

CRediT authorship contribution statement

Shweta Priyadarshini Dash: writing of the original draft manuscript and investigation.

Pushpa Choudhary: feed preparation and feed data analysis, investigation, formal analysis, and supervision.

Sasmita Mohanty: investigation.

  1. Prince: Writing- review & editing

Chinmayee Muduli: formal analysis and final manuscript draft preparation.

Arabinda Das: formal analysis.

Priyabrat Swain and Sudhansu Sekhar Mishra: visualization, resource acquisition, and supervision. All the authors have given consent for the final submission to the journal.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Competing interests: The authors have no relevant financial or non-financial interests to disclose

References

  1. FishStatJ - Software for Fishery and Aquaculture Statistical Time Series - Fisheries and Aquaculture (2024).
  2. The State of World Fisheries and Aquaculture (2024).
  3. Sahu I, Das BK, Marhual N, Samanta M, et al. Toxicity of Crude Extracellular Products of Aeromonas hydrophila on Rohu, Labeo rohita (Ham.). Indian J Microbiol 51 (2011): 515–20. 
  4. Suguna T. Infectious Fish Disease Occurrence in Carp Culture Ponds of West Godavari District, Andhra Pradesh, India. Int J Curr Microbiol Appl Sci 10 (2021): 376–86. 
  5. Mohanty BR, Mishra J, Das S, Jena JK, et al. An Outbreak of Aeromoniasis in an Organized Composite Carp Culture Farm in India: Experimental Pathogenicity and Antibiogram Study. J Aquac 15 (2023): 27–37. 
  6. Muduli C, Tripathi G, Paniprasad K, Kumar K, et al. Virulence potential of Aeromonas hydrophila isolated from apparently healthy freshwater food fish. Biologia (Bratisl) 76 (2021): 1005–15. 
  7. Chen J, Liu N, Zhang H, Zhao Y, et al. The effects of Aeromonas hydrophila infection on oxidative stress, nonspecific immunity, autophagy, and apoptosis in the common carp. Dev Comp Immunol 105 (2020): 103587. 
  8. Dayana Senthamarai M, Rajan MR, Bharathi PV. Current risks of microbial infections in fish and their prevention methods: A review. Microb Pathog 185 (2023): 106400. 
  9. Chong CM, Shakir MZ, Lai KS, Liew HJ, et al. Microbes and fish diseases. In: Recent Advances in Aquaculture Microbial Technology. Elsevier (2023): 65–102.
  10. Aghamohammad S, Rohani M. Antibiotic resistance and the alternatives to conventional antibiotics: The role of probiotics and microbiota in combating antimicrobial resistance. Microbiol Res 267 (2023): 127275. 
  11. Schar D, Zhao C, Wang Y, Larsson DGJ, et al. Twenty-year trends in antimicrobial resistance from aquaculture and fisheries in Asia. Nat Commun 12 (2021): 5384. 
  12. Zhang W, Zhao J, Ma Y, Li J, et al. The effective components of herbal medicines used for prevention and control of fish diseases. Fish Shellfish Immunol 126 (2022): 73–83. 
  13. Semwal A, Kumar A, Kumar N. A review on pathogenicity of Aeromonas hydrophila and their mitigation through medicinal herbs in aquaculture. Heliyon 9 (2023): e14088. 
  14. Chen L, Deng H, Cui H, Fang J, et al. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 9 (2018): 7204–18. 
  15. Aly SM, ElBanna NI, Elatta MA, Hegazy M, et al. Effects of natural and synthetic immunostimulants on growth, feed utilization, immune status, and disease resistance against vibriosis in sea bream (Sparus aurata). Aquac Int 32 (2024): 2739–56. 
  16. Glamoclija N, Sevic K, Baltic B, Boskovic M, et al. Effects of phytobiotics on Cobb broiler production results, meatiness and chemical composition. Sci J Meat Technol 57 (2016): 89–94. 
  17. Rashidian G, Boldaji JT, Rainis S, Prokic MD, et al. Oregano (Origanum vulgare) Extract Enhances Zebrafish (Danio rerio) Growth Performance, Serum and Mucus Innate Immune Responses and Resistance against Aeromonas hydrophila Challenge. Animals 11 (2021): 299. 
  18. Reverter M, Bontemps N, Lecchini D, Banaigs B, et al. Use of plant extracts in fish aquaculture as an alternative to chemotherapy: Current status and future perspectives. Aquaculture 433 (2014): 50–61. 
  19. Zhao X, Chen W, Zhang Y, Gao X, et al. Dietary guar gum supplementation reduces the adverse effects of high-fat diets on the growth performance, antioxidant capacity, inflammation, and apoptosis of juvenile largemouth bass (Micropterus salmoides). Anim Feed Sci Technol 308 (2024): 115881. 
  20. TB, Pathinathan P, Sanjay G, Jayakumar N, et al. PHYTOBIOTICS AND THEIR ROLE IN ENHANCING THE FISH AGAINST THE DISEASES (2024). 
  21. Bahi A, Bhaskaracharya R, Esteban MA, Guardiola FA. Dietary administration impact of olive pulp on growth performance, metabolic profile, immune status, and antioxidant potential of gilthead seabream (Sparus aurata L.). Front Sustain Food Syst 8 (2024): 1395436. 
  22. Chi C, Giri SS, Jun JW, Kim HJ, et al. Immunomodulatory Effects of a Bioactive Compound Isolated from Dryopteris crassirhizoma on the Grass Carp Ctenopharyngodon idella. J Immunol Res (2016): 1–10. 
  23. Dotta G, De Andrade JIA, Tavares Gonçalves EL, Brum A, et al. Leukocyte phagocytosis and lysozyme activity in Nile tilapia fed supplemented diet with natural extracts of propolis and Aloe barbadensis. Fish Shellfish Immunol 39 (2014): 280–4. 
  24. Nhu TQ, Bich Hang BT, Cornet V, Oger M, et al. Single or Combined Dietary Supply of Psidium guajava and Phyllanthus amarus Extracts Differentially Modulate Immune Responses and Liver Proteome in Striped Catfish (Pangasianodon hyphophthalmus). Front Immunol 11 (2020): 797. 
  25. Bettin Thomas T, Thirumalaikumar E, Sathishkumar R, Rajeswari MV, et al. Effects of dietary Andrographis paniculata extract on growth, haematological, immune responses, immune-related genes expression of ornamental goldfish (Carassius auratus) and its susceptibility to Aeromonas hydrophila infection. Aquac Rep 33 (2023): 101850. 
  26. Habibnia M, Bahrekazemi M, Bahram S, Javadian SR, et al. Growth performance, hematological and immune parameters, and mRNA levels of cytokines and antioxidant-related genes in rainbow trout (Oncorhynchus mykiss) fed on Pediocuccus pentosaceus and/or ferulic acid. Anim Feed Sci Technol 308 (2024): 115872. 
  27. Zhang X, Sun Z, Wang Y, Cao Y, et al. Enhancement of growth, antioxidative status, nonspecific immunity, and disease resistance in gibel carp (Carassius auratus) in response to dietary Flos populi extract. Fish Physiol Biochem 48 (2022): 67–83. 
  28. Li Y, Dong X, Zhang Y, Xiao T, et al. Astragalus polysaccharide improves the growth, meat quality, antioxidant capacity and bacterial resistance of Furong crucian carp (Furong carp × red crucian carp). Int J Biol Macromol 244 (2023): 124999. 
  29. Mohanty S, Ferosekhan S, Choudhary P, Chandan NK, et al. Dietary supplementation of Terminalia arjuna bark extract improved growth, biochemical parameters and innate immunity in Heteropneustes fossilis larvae. Anim Feed Sci Technol 306 (2023): 115793. 
  30. Patra I, Dewi AP, Fawzi M, Hussam F, et al. Effects of Dietary Medlar (Mespilus germanica L.) Extract on Growth Performance, Innate Immune Characteristics, Antioxidant Status, and Responses to Crowding Stress in Rainbow Trout (Oncorhynchus mykiss). El Basuini M, editor. Aquac Nutr (2023): 1–13. 
  31. Ahmed SS, Alqahtani AM, Alqahtani T, Alamri AH, Menaa F, Mani RK, et al. Green Synthesis, Characterizations of Zinc Oxide Nanoparticles from Aqueous Leaf Extract of Tridax procumbens Linn. and Assessment of their Anti-Hyperglycemic Activity in Streptozoticin-Induced Diabetic Rats. Materials 15.22 (2022):8202. 
  32. Kusi IO, Obirikorang KA, Adjei-Boateng D. Diets supplemented with phytobiotics Calopogonium mucunoides, Ocimum gratissimum, and Tridax procumbens improve growth, immunity, and Oreochromis niloticus resistance to Streptococcus agalactiae. Aquac Int 32.6 (2024): 7215-7234.
  33. Monir W, Abdel-Rahman MA, El-Din Hassan S, Mansour ES, Awad SMM. Pomegranate peel and moringa-based diets enhanced biochemical and immune parameters of Nile tilapia against bacterial infection by Aeromonas hydrophila. Microb Pathog 145 (2020): 104202.
  34. Govindharaj GPP, Jena M, Annamalai M, Basana-Gowda G, Muthiah C, Patil N, et al. Toxicity of water pepper, Persicaria hydropiper (L.) extracts against Nilaparvata lugens (Stål) and non-targeted effect on earthworm. Ind Crops Prod 187 (2022): 115309.
  35. Blois MS. Antioxidant Determinations by the Use of a Stable Free Radical. Nature 181.4617 (1958): 1199-1200.
  36. El-Refai AA, Ghoniem GA, El-Khateeb AY, Hassaan MM. Eco-friendly synthesis of metal nanoparticles using ginger and garlic extracts as biocompatible novel antioxidant and antimicrobial agents. J Nanostructure Chem 8 (2018): 71-81.
  37. Elabd H, Wang HP, Shaheen A, Matter A. Astragalus membranaceus nanoparticles markedly improve immune and anti-oxidative responses; and protection against Aeromonas veronii in Nile tilapia Oreochromis niloticus. Fish Shellfish Immunol 97 (2020): 248-256.
  38. Chemists (US) A of OA, Methods A of OAC (US) C on R of. Official and tentative methods of analysis of the Association of Official Agricultural Chemists (1980).
  39. Das KM, Singh R, Subramanya S, Ojha SK, Almansoori T, Gokhale D, et al. Serum Biochemical Parameters as a Surrogate Marker for Chest Computed Tomography in Children with COVID-19. Future Virol 16.9 (2021): 601-609.
  40. Ellis AE. Lysozyme Assays. Techniques in fish immunology 1 (1990): 101-103.
  41. Quade MJ, Roth JA. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet Immunol Immunopathol 58.3-4 (1997): 239-248.
  42. Anderson DP, Siwicki AK. Simplified assays for measuring nonspecific defense mechanisms in fish. In: Seattle, WA: Fish Health Section/American Fisheries Society Meeting (1994): 26–35. 
  43. Doumas BT, Ard Watson W, Biggs HG. Albumin standards and the measurement of serum albumin with bromcresol green. Clin Chim Acta 31.1 (1971): 87-96.
  44. Choudhary P, Swain P, Das R, Sahoo SN, Das KC, Patil PK, et al. Effect of Graded Levels of Dietary Emamectin Benzoate on Immunity, Enzyme Activity, and Withdrawal Period in Labeo rohita Juveniles (Hamilton, 1822). Kubilay A, editor. Aquac Nutr 2022.1 (2022): 4688312.
  45. Hoseinifar SH, Khalili M, Rufchaei R, Raeisi M, Attar M, Cordero H, et al. Effects of date palm fruit extracts on skin mucosal immunity, immune related genes expression and growth performance of common carp (Cyprinus carpio) fry. Fish Shellfish Immunol 47.2 (2015): 706-711.
  46. Oriol Sunyer J, Tort L. Natural hemolytic and bactericidal activities of sea bream Sparus aurata serum are effected by the alternative complement pathway. Vet Immunol Immunopathol 45.3-4 (1995): 333-345.
  47. Safari O, Sarkheil M. Dietary administration of eryngii mushroom ( Pleurotus eryngii ) powder on haemato-immunological responses, bactericidal activity of skin mucus and growth performance of koi carp fingerlings ( Cyprinus carpio koi). Fish Shellfish Immunol 80 (2018): 505-513.
  48. Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25.4 (2001): 402-408.
  49. Kar B, Mohanty J, Hemaprasanth KP, Sahoo PK. The immune response in rohu, Labeo rohita (Actinopterygii: Cyprinidae) to Argulus siamensis (Branchiura: Argulidae) infection: kinetics of immune gene expression and innate immune response. Aquac Res 46.6 (2015): 1292-1308. 
  50. Saurabh S, Mohanty BR, Sahoo PK. Expression of immune-related genes in rohu Labeo rohita (Hamilton) by experimental freshwater lice Argulus siamensis (Wilson) infection. Vet Parasitol 175.1-2 (2011): 119-128.
  51. Mohanty BR, Sahoo PK. Immune responses and expression profiles of some immune-related genes in Indian major carp, Labeo rohita to Edwardsiella tarda infection. Fish Shellfish Immunol 28.4 (2010): 613-621. 
  52. Dash P, Kar B, Mishra A, Sahoo PK. Effect of Dactylogyrus catlaius (Jain 1961) infection in Labeo rohita (Hamilton 1822): innate immune responses and expression profile of some immune related genes. (2014).
  53. Dash P, Sahoo PK. Expression Profile of Pro-Inflammatory Cytokines in Head-Kidney Leucocytes of Rohu Following Stimulation with Poly I: C. Int J Mar Biol Res 2.1 (2017): 1-6.
  54. Mohapatra A, Karan S, Kar B, Garg LC, Dixit A, Sahoo PK. Apolipoprotein A-I in Labeo rohita: Cloning and functional characterisation reveal its broad spectrum antimicrobial property, and indicate significant role during ectoparasitic infection. Fish Shellfish Immunol 55 (2016): 717-728.
  55. Popoola OM, Behera BK, Kumar V. Dietary silver nanoparticles as immunostimulant on rohu (Labeo rohita): Effects on the growth, cellular ultrastructure, immune-gene expression, and survival against Aeromonas hydrophila. Fish Shellfish Immunol Rep 4 (2023): 100080.
  56. Sharma A, Paul A, Parida S, Pattanayak S, Mohapatra A, Rajesh Kumar P, et al. Dynamics of expression of antibacterial and antioxidant defence genes in Indian major carp, Labeo rohita in response to Aeromonas hydrophila infection. Microb Pathog 125 (2018): 108-115.
  57. Soltanian S, Fereidouni MS. Effect of Henna (Lawsonia inermis) extract on the immunity and survival of common carp, Cyprinus carpio infected with Aeromonas hydrophila. Int Aquat Res 8 (2016): 247-261. 
  58. Hoseinifar SH, Zoheiri F, Caipang CM. Dietary sodium propionate improved performance, mucosal and humoral immune responses in Caspian white fish (Rutilus frisii kutum) fry. Fish Shellfish Immunol 55 (2016): 523-528.
  59. Iswarya A, Vaseeharan B, Anjugam M, Gobi N, Divya M, Faggio C. β-1, 3 glucan binding protein based selenium nanowire enhances the immune status of Cyprinus carpio and protection against Aeromonas hydrophila infection. Fish Shellfish Immunol 83 (2018): 61-75.
  60. Zar JH. Biostatistical analysis. Pearson Education India. (1999).
  61. Estaiano De Rezende RA, Soares MP, Sampaio FG, Cardoso IL, Ishikawa MM, Lima Dallago BS, et al. Phytobiotics blend as a dietary supplement for Nile tilapia health improvement. Fish Shellfish Immunol 114 (2021): 293-300.
  62. Hoseinifar SH, Sun YZ, Zhou Z, Van Doan H, Davies SJ, Harikrishnan R. Boosting Immune Function and Disease Bio-Control Through Environment-Friendly and Sustainable Approaches in Finfish Aquaculture: Herbal Therapy Scenarios. Rev Fish Sci Aquac 28.3 (2020): 303-321.
  63. Kalaiselvan P, Malarvizhi K, Ranjan A. Exploring phytobiotics in aquaculture: sources, mode of action, effects, administration, and its bioavailability in fish. Aquac Int 32.5 (2024): 5737-5799.
  64. Gupta A, Gupta SK, Priyam M, Siddik MAB, Kumar N, Mishra PK, et al. Immunomodulation by dietary supplements: A preventive health strategy for sustainable aquaculture of tropical freshwater fish, Labeo rohita (Hamilton, 1822). Rev Aquac 13.4 (2021): 2364-2394.
  65. Adeshina I, Abdel-Tawwab M, Tijjani ZA, Tiamiyu LO, Jahanbakhshi A. Dietary Tridax procumbens leaves extract stimulated growth, antioxidants, immunity, and resistance of Nile tilapia, Oreochromis niloticus, to monogenean parasitic infection. Aquaculture 532 (2021): 736047.
  66. Ojobe T, Omoregie E, Ufodike E, Absalom K. Potentials of Indigofera (Indigofera suffruticosa) and Tridax (Tridax procumbens)leaves as dietary components for the juvenile Cichlid (Oreochromis niloticus). Afr J Nat Resour (2005).
  67. Ashokkumar R, Ramaswamy M. Phytochemical screening by FTIR spectroscopic analysis of leaf extracts of selected Indian Medicinal plants. (2014): 395-406.
  68. Patkar SS, Khan SY. Evaluation of Antioxidant Activity and FTIR Spectroscopic Analysis of Bark Extracts of Psydrax dicoccos Gaertn. Int J PLANT Environ 10.02 (2024): 279-285.
  69. Kord Z, Taheri A, Ghaffari M, Sharifian S. Incorporation of Prosopis cineraria Extract Improved the Mechanical, Barrier and Antioxidant Properties but Not the Antibacterial Activity of Tigertooth croaker Fish Scale Gelatin Film. Foods 13.4 (2024): 538.
  70. Xavier MJ, Conceição LEC, Valente LMP, Colen R, Rodrigues ACM, Rocha RJM, et al. Dietary Natural Plant Extracts Can Promote Growth and Modulate Oxidative Status of Senegalese Sole Postlarvae under Standard/Challenge Conditions. Animals 11.5 (2021): 1398.
  71. Saleem M, Hussain SM, Ali S, Rizwan M, Al-Ghanim KA, Yong JWH. Effects of the medicinal plant, Tamarindus indica, as a potential supplement, on growth, nutrient digestibility, body composition and hematological indices of Cyprinus carpio fingerlings. Heliyon 10.13 (2024).
  72. Alexander CP, John Wesly Kirubakaran C, Michael RD. Water soluble fraction of Tinospora cordifolia leaves enhanced the non-specific immune mechanisms and disease resistance in Oreochromis mossambicus. Fish Shellfish Immunol 29.5 (2010): 765-772.
  73. Mazumder A. Evaluation of In vitro Antioxidant Activity of Some Plants of Cachar District, Assam. Pharmacogn J 2.9 (2010): 289-292.
  74. Rana M, Mandal S, Kabita Sk. Spirulina in fish immunity development: find the black box. Rev Fish Biol Fish 34.2 (2024): 623-646.
  75. Harikrishnan R, Devi G, Doan HV, Tapingkae W, Balasundaram C, Arockiaraj J, et al. Changes in immune genes expression, immune response, digestive enzymes -antioxidant status, and growth of catla (Catla catla) fed with Astragalus polysaccharides against edwardsiellosis disease. Fish Shellfish Immunol 121 (2022): 418-436.
  76. Muduli C, Rathore G, Srivastava R, Singh RK, Tripathi G, Prasad KP, et al. Immuno-pathological changes in Indian catfish Clarias magur (Hamilton, 1822) upon experimental challenge with Aeromonas hydropila. Indian J Fish 3 (2021).
  77. Ahmadifar E, Pourmohammadi Fallah H, Yousefi M, Dawood MAO, Hoseinifar SH, Adineh H, et al. The Gene Regulatory Roles of Herbal Extracts on the Growth, Immune System, and Reproduction of Fish. Animals 11.8 (2021): 2167.
  78. Sopinka NM, Donaldson MR, O’Connor CM, Suski CD, Cooke SJ. Stress indicators in fish. In: Fish physiology. Academic Press 2016. 405-462.
  79. Abdel-Tawwab M, El-Araby DA. Immune and antioxidative effects of dietary licorice (Glycyrrhiza glabra L.) on performance of Nile tilapia, Oreochromis niloticus (L.) and its susceptibility to Aeromonas hydrophila infection. Aquaculture 530 (2021): 735828.
  80. Elabd H, Wang HP, Shaheen A, Yao H, Abbass A. Feeding Glycyrrhiza glabra (liquorice) and Astragalus membranaceus (AM) alters innate immune and physiological responses in yellow perch (Perca flavescens). Fish Shellfish Immunol 54 (2016): 374-384. 
  81. Abdel-Razek N, El-Sabbagh N, Khalil RH, Abdel-Tawwab M. Prophylactic effects of dietary caper (Capparis spinosa) extracts on the control of Streptococcus agalactiae infection, growth, immune-antioxidant, and inflammation cytokine responses of Nile tilapia fingerlings. Fish Shellfish Immunol 142 (2023): 109126.
  82. Ángeles Esteban M. An Overview of the Immunological Defenses in Fish Skin. ISRN Immunol 1 (2012): 853470.
  83. Kiron V. Fish immune system and its nutritional modulation for preventive health care. Anim Feed Sci Technol 173.1-2 (2012): 111-133.
  84. Guardiola FA, Cuesta A, Esteban MÁ. Using skin mucus to evaluate stress in gilthead seabream ( Sparus aurata L.). Fish Shellfish Immunol 59 (2016): 323-330.
  85. Parra D, Reyes-Lopez FE, Tort L. Mucosal Immunity and B Cells in Teleosts: Effect of Vaccination and Stress. Front Immunol Frontiers in immunology 6 (2015): 354.
  86. Safari R, Hoseinifar SH, Van Doan H, Dadar M. The effects of dietary Myrtle ( Myrtus communis ) on skin mucus immune parameters and mRNA levels of growth, antioxidant and immune related genes in zebrafish ( Danio rerio ). Fish Shellfish Immunol 66 (2017): 264-269.
  87. Hoseinifar SH, Khodadadian Zou H, Paknejad H, Hajimoradloo A, Van Doan H. Effects of dietary white-button mushroom powder on mucosal immunity, antioxidant defence, and growth of common carp (Cyprinus carpio). Aquaculture 501 (2019): 448-454.
  88. Safari R, Hoseinifar SH, Nejadmoghadam S, Jafar A. Transciptomic study of mucosal immune, antioxidant and growth related genes and non-specific immune response of common carp (Cyprinus carpio) fed dietary Ferula (Ferula assafoetida). Fish Shellfish Immunol 55 (2016): 242-248.
  89. Cerezuela R, Guardiola FA, Cuesta A, Esteban MÁ. Enrichment of gilthead seabream (Sparus aurata L.) diet with palm fruit extracts and probiotics: Effects on skin mucosal immunity. Fish Shellfish Immunol 49 (2016): 100-109.
  90. Guardiola FA, Bahi A, Jiménez-Monreal AM, Martínez-Tomé M, Murcia MA, Esteban MA. Dietary administration effects of fenugreek seeds on skin mucosal antioxidant and immunity status of gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol 75 (2018): 357-364.
  91. Anja, Adic, emanja, Rgovic, Na, Ugic. Lady’s mantle (Alchemilla vulgaris L., Rosaceae): A review of traditional uses, phytochemical profile, and biological properties. sirovine 40 (2020): 66-74
  92. Aher Akash Bhagwan. Phytochemical And Pharmacological Activity Of Tridax Procumbems Linn. Int. J. Pharm. Sci 5 (2024)1691-1697. 
  93. Giri SS, Sen SS, Chi C, Kim HJ, Yun S, Park SC, et al. Effect of guava leaves on the growth performance and cytokine gene expression of Labeo rohita and its susceptibility to Aeromonas hydrophila infection. Fish Shellfish Immunol 46.2 (2015): 217-224.
  94. Paria A, Muduli C, Rathore G. Understanding the molecular response of non-mammalian toll-like receptor 22 (TLR22) in amphibious air-breathing catfish, Clarias magur (Hamilton, 1822) to bacterial infection or ligand stimulation through molecular cloning and expression profiling. Gene 866 (2023): 147351.
  95. Zemheri-Navruz F, Acar Ü, Yilmaz S. Dietary supplementation of olive leaf extract increases haematological, serum biochemical parameters and immune related genes expression level in common carp (Cyprinus carpio) juveniles. Fish Shellfish Immunol 89 (2019): 672-676.
  96. Tiwari U, Rastogi B, Singh P, Saraf DK, Vyas SP. Immunomodulatory effects of aqueous extract of Tridax procumbens in experimental animals. J Ethnopharmacol 92.1 (2004): 113-119.
Article Views
1,989
Total Views
Download PDF
Article Details
  • Volume9
  • Issue2
  • Pages141–157
  • Published30 Apr 2025
  • ISSN2572-9365
  • DOI10.26502/ami.936500217
Journal

Archives of Microbiology & Immunology

Impact Factor: 3.5
Submit Manuscript
© 2016–2026, Copyrights Fortune Journals. All Rights Reserved.